Description :
From Genome Similarity Track
Location :
contig_31:5438- 8799
Transcript NameFunction/comments
g6033.t1hypothetical protein

Sequence
3361 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGT
ATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCA
GAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATG
ATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGT
GTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGT
CGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCC
TCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCACTTGCTTTATGCCTGC
CTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAAT
TACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGC
GCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATG
GTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAA
GCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACC
CTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGATCTCCCGCGACAGATCTTTTTTCGACTTTGTGC
GGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAA
TGGTACAGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCA
AACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGG
TCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTT
TCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGC
CACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGAC
ACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGT
GTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCT
ATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTC
GCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAG
GTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAAC
AACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAG
GATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAA
AGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGTG
GAGACGGGGGCAACATCTGATCCCACTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTG
ACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATA
GGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAG
ACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCG
CTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCG
GGCTACTTTATGATTATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAA
CTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTG