Description :
From Genome Similarity Track
Location :
Scaffold_584:5438- 7314
Transcript NameFunction/comments
g14601.t1hypothetical protein

Sequence
1876 bases(100 bases per row)
GATCGGGCGCGTTGTGCGACCGGCTTGGCCGTCCCAACGTCCAAATCACAAGTCACAAGTCACAAGTCACTCCTCTTGCTGGAGCAGGAGCAGCATTTCC
GTCACCCAGAAAGATAGAGCGGTGGTACTTCAGGATGGACCGAAACTTTTGCTCTTCCAGAGGTGATGTCGTTTCCGAATCCCCCACATCAGCCGCATCA
ATATCACATGTCGGGCTCAACTCTTGGAGTTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGGATGTACACAGCGG
GTTCCAAATCTAGTTCTTCTGCGTTCAGACGCATTCACCTCTCATACTCAATTTCCAACTTTTGGATTGGGGTAGAGAGCATGGCTTGGGTTTGCTGATC
CCGGAGTTCGTCCAATCCTGACAAGTCATCCAGACAATCGTTCACATCGTCAGCACCTTCATCCGGAAACTCTTCATTCAGGCTAATCGAATCAAAGAAT
TCATCTCCGTCCGAATCCACGTCGTCTGTCAGAAGTTCTACGTCTTCCAAACGTTCTTCAACCCTTGGTATGACTTCCGACTCCCTTGGATGACATCCGT
CGCCAGTATCTTCCGGACGTGGCACTTCCTCAACCTCAGGGTCCTTTTTCAGCTTTACCGTGTCTTCTGCGATGACTGCATCTGGAAGAGTTTCCTCCAC
TTTCGGGCGTAAGACTCGAGGCAGCTCCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAACCAATAGCTTAGCCGGCCATGAGTAT
TCGGACTTCTGGACGCAAGGAGGTTCGGCGTCCCTCATCATCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGA
GAGTCTGCCACTCCTGATACCTTCGGAGACCCGGGCGGACAAAACGTCCTGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCGTCCGAGTGTCAATG
CTAAGACACCTTCCGGAAATGTTCACCACTTTGATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGAGTTACCCATCGATCTCCCCGACCAGCCC
ATACCACATCACGTTGTGGATTGCTCTGTCCGTAATGTATCCGGACGATTGCATGTTCACCTGGACGCAGGAAAAGCTCTTCACGCGGTCTCACCGGAAG
GTCCAAACCTCTGTGGTAATGATCCGCACCACGTCCTGATAGCAACACAGTTTCTTCATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACT
CCAGCGGAATACATGAAATTCATTCCAAGCAACACGTCGACACCTTCACCAATGTTCGCGACCCAGAGCTCCAAGACATACACAATTCTTGGACCTAAAG
TGATTTTCACTTCAGCACTCGCCGTGATGATTGTCAAAACGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTAGTTTGAGTTTGAGTCTACG
CGCAAGATCCAAACTCACCATGCTTTCTGACGCTCCGGAATCCAAAAGGATGTCTGTCCGGCAATTGTTTACCGCTCCATGAACCATCGCAATCCGTTTC
GTGTCATCCAAACAGTGATCTTCCCACCAGCCATATCGTTCGCCTGGTCCCAATCGGAATTCAACAGGTACATCCGGATCTTTTACTTCCGGCCGTACAC
CTTCCGACAGAACTCGTTCAGAACGAAGTTCGTCTGAAAGAGGGTCACCACTTTCCGGAGTCACGGTCATGCATTGAAGTTTATCCTGTTTTTGGCGTCT
CAACTCCGGACCAACATACACTAGAAGACACATATTGGGGGGTTTCTTCAGACCGTCGCGTTATGGATCCCCATCC