Description :
From Genome Similarity Track
Location :
scaffold_158:54362- 56346
Transcript NameFunction/comments
g4798.t1 myosin-like protein

Sequence
1984 bases(100 bases per row)
GGCGCCGAGGACATGTGCGAGTTGGGCCATCTGCACGAACCTGCTATCGTCTACAACGTCCGTGAACGGTTCTTGGCGAGAGAGCCATACACTTACACAG
GGAAGATCGTTGTAGCGGTAAATCCGTACCAATGGATTAAGGAGCACTACTCGGAGGAGCTGAGAGATATGTACACGCAGAGGCCATGGGACGAGATGCC
ACCACACGTGTACGCGACGAGCGCCGAAGCTTTCCACCACATGAAGCAGCACCGGATCCCTCAGAGTATTCTTGTGAGTGGAGAATCTGGTGCTGGTAAG
ACGGAGACGGTTAAAATCATGATGGAACATCTTGCTAGCATCTCTATGGGCATCGCTAAGAGGCTGCATCCCGCTGAAAGTGGAGAGACGATTGTTGTGG
AGAAGGTGTTAAAGAGTAACCCGTTGCTGGAATCTTTTGGTAATGCGAAAACGATCCGCAACGACAACTCCAGTCGATTCGGAAAGTTTACGCAGCTCCA
GTTTAACAACGACTACTGTCTCGTTGGAGCCGAGTGTCGCCACTATCTGCTGGAGAAATCGCGCGTGGTGGCACAGGCTGCGGGTGAACGCAACTACCAC
ATCTTCTACCAGCTTGTGAGTGCGAAGGAGGGCGCGTTCGGCTTCAGCGACGACACCTCAGCCAAGGAATTCCGCTATTTGCAGGACGAGAAGCTCATCT
TGGATGGGAAGACGGACTTGGAGCGCTACCAGGTGACGCGAGATGCGCTGACTACCATTGGGCTCAGCGATACGGAGCAGAACGAACTCTTTAGCGCTCT
TTGCGGTATCTTGCGTCTGGGACAGCTTGACTTTGTGCCGCTGGAATCTAACAAGGATGATGCCAGCCAGGCTGTTGCTTCTCTGAATGTGTCAGCACCG
TCCGGGACTGTCACAGCTGAGCAGATTGAGCAGCAGAAGAAGGAAATCGAGCAGTGTGCGAAGCTTCTGGGTGTGGAAGTTGGAGCGCTGAGTAAGCAGC
TCTGCAGTCGCACCGTGAAGGCTCGCCAGGAAGTGTATTGTGTACCGCTGTCGGCTCATCACGCGAGTAATAACCGTGATGCTCTGGCAAAGGAAATTTA
CGCCCGCGTATTCGGTTATCTAGTGCGCCGTGTGAACTACAGTATCTCCAATACGGCGGGCAGAGCTGTTTCAACGCCGTCGTACCTGCACATTGACTTG
CTGGATATCTTTGGTTTTGAGTCGTTCAAACACAACAGCTTTGAACAGTTCTGCATTAACTTTGCAAACGAAAAGTTGCAGCAGAAGTTTACGTTGGATG
TGTTCAAGACGGTGCAAGAGGAGTACCAGCAAGAAGGTGTTGCTTGGGAGTTCGTGAAGTACCGAGACAATCAAGATATGCTGGATCTCCTGGAGAACTC
GATGGGCGTGATGGCTCTGCTGAACGAAGAATGTGTGCGTCCCATGGGTAGTGACCAGTCGTTCGTGTCCAAGCTCGTGTCACTGCGTGAGTCACACCCT
CGCCTGGAGCGAGCGCGTCTTAGCCAAACACACTTCTTGTTGCACCACTATGCGGGCCCTGTGACGTACGACGCGGATGGTTTTGTTGAGAAGAACAAGG
ACTCACTTCAAACCGATCTATTAGAGCTACTCGGCACGAGCTCTAATGGCTTGATGTCAATGGTGTTCGGCGATGACGACAATACTGCATTCATGACGGA
CTCCGATTTGGCCGTCCGTGCCGCAACCATGATGGAGAATGGCCGACGCAGCACGGTAAGCCGTAAAACTTCTACGTTCATGCAAGAAACAGTGAGCTAC
AAGTTTAAGGCACAGTTGTCACTGCTGATGAGCGACATCTCTAGCACTGAGGTGCACTACGTGCGCTGTATTAAGCCTAACTCACAAAAGAGCCCGAGCA
TCTACGAGATCGATGCTGTGGTAAACCAGCTTCGCTGCGCAGGTGTTGTTGAAGCTATTCGAATTACACGAGCTGCGTTCCCGA