Description :
From Genome Similarity Track
Location :
Scaffold_667:5436- 8630
Sequence
3194 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCGATC
GCCGCTAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCAAGCACCGATCCCGACTG
TACGTGCGGACGAAGAGCACCTGGTGATAAGTTTCGATGGATCCGCCCGCGTCAAGCGAGGCGGGGGCGCGTACAGCGCGATCTTGTGGAAGTTACCCGA
ATGGAGTGTGGTGAAGGCACGATCGGGGTATGCTGAAGGGTTGACTATTAACGAGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTTGACGGC
GTAGATCGAGGCCGGTTGGTGGTCTGCGGTGATTCCAACCTGGTGATCCGGCAAGTACGGGGCGAAATCGACTGCAAAGCACCTAAGCTGACATTGTTGA
AGCAGAAGGTGCTGGACCAACTACGGAACTGGCCATATCACGAGCTGTTACATGTGAAACGAGACTGGAACGGGAGTGCAGACAGCCTGGCCAGTGCAGC
ACTCCAACGTGAAGGGGTCGTCGTCGTCGAGGATGAGGTCGATCATGAGGATCTAGTGACACTGAACCGACTTGATGAGATCCTGGTTATTCGATCGGAT
GAGTCGATCGCCCGACTATCACCGATGACCACCCGATCGGGCGCCAGATCACGGTCGAACCCGACCGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGA
TCGACCGAATTCGTCGAGCTCAAGATGAAGAAACGTGGATCGCGGGTATGAAGAAGTACCTGATGGGAGATGTGGCTGCACTGACGCAGGATGAGGCTCG
ATCCTTTGGCAACCTCGCAGCGGATTATGAGATCGACGGTGATAATCTGCCGTTCTATTGCCCACCCTCCAAACGATCGGAGGCAGATCGAGATGGGCTG
ATGAGGCTGGTTGCACCAGAGACGCTGCATCAAGATATCTTGCATCACTATCTCTCCACTCTGGAAGGTGGACACCAAGGGATCGGGCGTACATACCAGC
GGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGCCGACTGCGAGACCGGCAAAGGACGACCCACGAT
CAGGGGCGAGCCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCGATGGATCACATACCTTCGCTACCCAAGTCGTACAAGGGTAATACG
GAAATGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCGAGCTCGTCCCGAACGGCGCAGACGATCGCCAAGTCTTATGAAGAGTGCG
TGTTCCGGCGATTTGGTGCTAGCGAGGTGAGCAGGCATGATCGCGAACCGGGATTTATGGCCGACTTCTTCCGCGCCTTTAACAAGATTCTGGG