Description :
From Genome Similarity Track
Location :
Scaffold_32:543305- 546232
Transcript NameFunction/comments
Sapdi_VS20SDRG_09916hypothetical protein

Sequence
2927 bases(100 bases per row)
TGCCCCAACTCGATCCACACGAGCAAGTACACGCTCTGGAACTTTGCCTTCGTCTTCTTCCACATGCAGTTCAGCCGCCTCGCCAACGTCTACACCTGCA
TCGTCGTCGCCCTCTGCTTCTTCAGCTTCTCTCCTGTCGACCCAGCGTCAAGCTTGCTTCCGCTGCTCATCGTCTTTGCGACCGCAGCGATCAAGGACGT
GTCCGAAGACCTCCGGCGGCAAAAGGCCGACCGCGACGTCAACTCCAAGCCGACGCACGTCTTGCGCAGCAACGGCCAGATCGAGCTGCTCCAGTGGCAG
CAAGTCCAGGTCGGCGACCTCCTCGTGCTGTACGAGGGCGACGACATCCCGTCCGACTGCCTCTTGCTCGCGACGGGGTCGGACAACGGCCTCTGTTATG
TGCAGACGGCCAACTTGGACGGCGAGACGAACCTCAAGATCCGCCAGACCGTGTCGCAGGACCTCGACCTCGAGTCGATCCCAGGGATGCCCATCACTGT
AAGCTGCGACCTTCCGAGCAAAAATATGTTCGAGTGGTCGGCGTACGTGACGCTCGGCGACGTGAACCTCCCGGCGTCCATGGACAACCTCCTCTTGCGC
GGCAGCGAGATGTGCACGGCCGGATGGACCGTCGGCCTCGTCGTCTACACGGGCGCCGAGACCAAGATCGCGCTCAACGCAGCGAATCCGGACGCCAAGA
TCAAGCGCACGCTCGTCGAGAAGACGCTCGACTCGATGTTCATCGTGATCCTCGTGCTGCTCTTTTCGATCTCGATTGCGTGCACGCTCGGCAACAACAA
CTGGAGCTTCGAGGTCGATTCAAAGAAGAGCAAGGCCAACAACGTGGCGGCCGTCGTCGCGCCCTACTATCTCGGACCTGCGACCAACGACTACATCTTC
CTCAGCTACATCATTCTCTTCAACAACCTCATCTCGCTCTCCATGTACGTGACCATGGAAGGCGTCCGCTTCGTGCACGCGCGCTACATCGAGAACGACT
TGACCATGTACGACGCGCCGACCGACACGCCGGCGCAAGTGCGCAACAGCAACATCAACGAAGACCTCGGGCAGGTCAAGTACATCTTCTCCGACAAGAC
GGGTACGCTTACGCGCAACGAAATGGTGTTTGCCAAGTGCTCGATCGCTGGCCTCAAGTACAACGACGCGCCCGAGGACGAGACGATTGCCAAGCCGCCG
CGGCCCGGCACCCGCTTCAACGACCCGCGGCTTCTCGCCCGCTACGATGCCAACCACGCGACAAAGGCCGACATTCACGAATTCCTGGTGCTGCTCATGC
TCTGCAACTCGGCGATCCCACAGGTGCAGGACGACGGCAGTCTTCTGTACCAGTCGTCGTCGCCAGACGAACAAGCGCTCTGTGCGGCGGCGCGCGACCT
TGGCTTCTCGCTCGAGCGCCGGTCTGGCGCCACGTGCTACGTCAACATTCGCGGCTCCGAGACCTCGTACGAGATCCTTCACGTGCTCGAGTTTACTTCG
GACCGGAAGCGCATGTCGGTGCTCTGCAAGAAGAAGGACGACGACACGATCTTCCTCTACTGCAAGGGCGCCGACGACGTGATTCTCGAGCGCCTCGCCG
ACGACCATGCCCAAGGGGCCGTTGTTGTGACGCGGGGCCATCTCCAGGAGTACGCCGCGCAAGGTCTGCGGACGCTCACGACGGCGGTGCGCATTCTCGA
TCCCGAGACGTACGCGGCGTGGCGCACGACGTACGAGGCGGCCGAGGCGGTGATGGACAAAGCGGCGCTGGACGCGGCCGCCGATGCGATCGAGCGTGAG
CTGCGGCTGCTCGGCGCGACGGCCATCGAAGATTTGCTGCAGGAAGGCGCCGAAGACTGCATCTACGCGCTCCGGAAGGCCGGCATCAACTTTTGGGTAC
TCACTGGCGACAAGAAGGAGACGGCCATCAGTATCGGCATGTCGTCGCAAGTGATTGACGAGACCATGGACGTCATTGTTCTCGACAAGAAGGACAAGGC
GTCCCTGACGGCGACGCTCGAAGAACTCTACGTGCACTTGGTCGAGGACCAGCGCTGGGACACGAAGAAGGACGACTCGATGACGCACGTGCTTCTCCAG
ACGCTACGCCGCGTGACGTCGACGGCTTACAACAACCTCATGGCTGCCATCTCGGGCAAGTACGAGCAGCGCCGCACGATGAAGCGCCGGAAGACGCGCC
TGCGCCTCTCGGCCGAGAACGGCACGGCGCTCAACTGGGAAGTGTACCCGCCGCGGCAGTCGCTGACCTCCAACCCCAACGCCAGTGAGATGCACGACGA
CGACGATGATGACATTGACGACGATCCTTACCTTGAGGCTGTCGACCTCGAGTGCATGGATGGCGAGGAGGACGAAAACGTCGAGTACGCCATGGTGATT
GACGGTCGCACGCTCACGATGGTGCTCGAGAACGACATCAAGTACCTCTTCTTGGCCGTCGCGCAGCAGTGCAAGTCGGTCATCTGCTGCCGGTGCTCCC
CGGCGCAAAAGGCCGCGGTCGTTCGCCTTGTGACCGAGCCAACGCTGCTCTGGACGCCGGGCAACATCACACTTGCGATTGGCGACGGTGCCAACGACGT
GCCGATGATCCAAGCGGCGAGCGTCGGTGTTGGCATTGGCGGCAAAGAAGGGCGGCAAGCCGTCCTCTCGAGCGACTACTCGATCGCGCAGTTCCGGTTC
CTCAAGCGGCTCCTCCTCGTGCACGGCAACTACAGCTACAAGCGCATCGCCAAGCTCATCTTGTTTTCGTTCATGAAGAACATTGCGCTGTCGCTGAGCA
ACTTTTTCTACGCGCCGGCGGCCAAGTACTCTGGCATCCTCACGTACCCGGGCATTTGCTTTACGATGTACAACGCGCTCTTCACGACGATCCCGATCGT
GTTTATTGCCATGTACAACCAAGACGT