Description :
From Genome Similarity Track
Location :
scaffold_1020:5432- 6748
Sequence
1316 bases(100 bases per row)
ATTTTAAAATCAAAAGCCATCTAACTTACCGATAAAGTAGTCTTCATTGACACAATCCTTACGAAGCCGGCCTTTTACGCCAGGCTTCACGTAAGTATGG
CCGACGTTCAGCCCTGTAGGCTGTCTTGCCTTCCAGCCAACCTTCAGCAGCCGACTCCACAGCTTCTTGAACGCTTTTGTGTCCACGTACTCCAGCGCGT
CCATCGCTTCGAGAAATGAGTGGCAGTTGGAGGGCGAGAGAGGGGGGCAAAATCGGTTTGTAGTGGCGTTTTCAAACATCTTCGCAGATTATACTGACTT
TTCTATGGCTGCCGGAAAATACCCGTCTATCTCAATAGCACTAACCCCCAACTATACAAACTTGCATATGCGGAAAATTCTCTTGACGCTCCCTGTGTAT
AAGCTCTCAACACATTACCACATGTAAGATCCCTTAATCTGTCGAATACAGAATCCCGCGTTAATTGGGTTAAGGATTTCACGATCCTGCTCCCACATCT
CTCATGATTACGATAAGTACCTTTTTTAAATATCACAAAAGACGGTAGAACTTTGTGTAAAAGGGCAAATTTTACGCTCTTTCAGGGTATTTCCAATCGT
ATTTTAAAAATCGCCGTAAGGGCGAAAAATGTGCCCTTATACCGCGAAACATGTCGGTGGTCATACGAGTAAGCTCCTTCTCTTGTCGTACCGTATTATT
CACCATCTCTTCCGAGTTTGCTTGTGCGATAGTTGCGGTTCTCTCCTCCAGCAACGCTCTACGCTGTAACACCAGAAGCGCGGGTAAACAATCAGGCACA
ACGCATGTTATGTCGCGATGCTTGCGTTGATCGACTCGAATTTTGATGCATTAAAGATCTCCACTGGTGTTAAGGTTTTGATCATCGTTTCAGCAGGTAG
TTTGATCGCTGAACACTGCTTGTTTCGTGAATGGGTCTACAGTCTACTGTAAAGTAATGAGAGCATTCTTGACACTACTACAAGGTGTCCCCATCAAAGT
TTGTGAGCACGGGGAGATAGCAGAAGATAGCAACTTCTTGTTCTGCTCGACTAGCGAGATATCACTTTTGTCGCAGCAATTACTTGGGAGGAAATACATC
CTAGTTACGACATTGATCAAATTTCCCTGCGTCATAGCGTCAAAAATGAGCGCACGGCCAATAACTCGTGCTTTGCGTGCGAACAATCGGGCATTAGCAG
CGTTGGCACGAAGCACAATCGAGTTGTGAACGTCGAGATATTGGCACTCGCCTGGCACAAGAGAATGATAAGGAACGTTGTAACATTGATCATATATATA
TTAGTTTGAGTGTCAT