Description :
From Genome Similarity Track
Location :
Scaffold_4:543126- 545024
Transcript NameFunction/comments
Physo_501189endo-1,3(4)-beta-glucanase, putative
Physo_332330Hypothetical protein

Sequence
1898 bases(100 bases per row)
CGTGCGTCTCGAGCAGCGGATGCACCTCGCCGCTATGGTTGGGCCTAGGACTGGGGGACAACATGGTTGAGCGAGCGACTGCAAGTGTCGGTGGCGAGGC
TGTCGTTGTTGGTGTTGCTGTTGAAGTGGTAGGCAAATTGAAGAGTGAGCTTAGAAGCGGCGGACGGGTTTCGGGGCCTGCTGAAGTTCAGTGTCCGTCC
GACCGACAGCCCCATGGGGCGCGCCGGCCGGCCGATCGCAGAGCAGGGCGTTGCGGTCACAGCAGCCACAAAGGCGCATATTTACGCCGGTGCGAAGCCA
TGAGCTGGAGCCGCGCCTGCGCCCGATGAGACGAAAGCGTGCTCTCGCTGTGGACGAGCCTGGCCGTTTTGCCGTAACAACCGTTAAATCGATACGCCCG
CACACGATTGGCTGAAAAGTTGAAGCAGGAATACACCCACTATAACTAATATAATGTGATCAATGATATTCGTATCTTCATACGTGTACTAGTACAAGAA
TAAGAGGATTCTAATATTTAATTACCCTTGCAATCTACCGCTACTCCCGCAAGCGGCTCGATTAACTGGATCGTCAGTCGAAAACTGCACTTTCAATACT
GAAGATTTGCACTGTCGACACCACTTCAACGTCGGCAGAAAACGGCTCAGCTCGGGCCAAGTGCAAGGTGGGCACGCCACAGTCTGGGCGCTCTGCATGC
AAAATCTCCTCTCATCGAGCGCGAAACGTGAGGCGGAGGGATGCCTCTTGGCCAGCAGCGCGCTGGCCGGCCCAGTCAGATCTTGCCGCCGGGAGGTTTC
GTCGCCGACCGTCATCGCTCAGCCCGCTGGGTGTCGCACCCGAAACGCAAATGGTGGCTGGGGAGTGTCAACCACTAAGACGATTAAAACAAATACTGTC
GCGACCGGCTCAGCTCAGTCGAATCTGGTGGTGTCACTGACTGAGTCTTTCGCAACTGTGAAAGCCCATGGTACGAACTGCAGGGCGAACGCCAAGGCTG
TCGGTTTGGTGTGGGTTCACTTGAAGCTGCAAAGGATCAGCGTGAAATCCAGCTCGATGTGTCCGTAGCGCGTTGTGGGGATCGTGTTCAGCGCATTGAA
GTTGCGGGCACAACGCGGACGACCAAGCAACAATTGACACCAAAAGCTCGCAAAGACGAGCCCCGAACTCTCGCTGGAAGTCCGCGTCGATCGTGTCGAT
CATCGGTAGAGCACACCAAATGCCAAGCGCTCCGAGCAATCGTCACCCCGAACCGAGGCCGCCGATGTGACATGAGATGGGAGTACACTCGTGGGGTGGA
CTGCATGTCGCTCATAAGAATGTCCCCCTGCGGCCAACTTGCTGGCAGCTCTGGGCGGGGTGCTTATCTGTTTCAAAGATGGCTACATGTACATCTTGGC
TCGACGTCAACGAAATAGTTTCATGTATTCGTACAAGCAAGCGGCTGCGCCGTTTGAGGCAACGCCAGCCTTATTCATTCTTGTGCAGTTGCTACAACTG
GTGACCTACCACCAACCCCCTCAAGTGTCACGGTGCGTCCGACGCTACCGACCCATTGCTTCGCTCTGCGAACAGCGGCGACAGCGACTCCTCCGCGACT
GAAACCTGAAGTTTCAGCGCCGAGAAGCCACTGAAGCAGTCGCGCAGAGTCGACTCCACGACTTCCTCTACCGTGTCGGGGGCTCGAAGGATCCGCTCGG
ACCCCACACGCTTCGGGTCCTCGACACTTTGGTTGCCCTTGCCTTTCTTCTTCTTCTGGCCCTTGTTGTTACCTCCGCTGAGCATGTCGGTCACGGCGCC
CGTGATACCCCTCGACTTCAAGTTGTTCTCGTCGTAAGCGCGACCGGCGGCTGCCAAGTCGTTCATGACGTCGGACGTCGCGTTCATGGCGCTGCGAG