Description :
From Genome Similarity Track
Location :
Scaffold_86:54305- 56920
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.9Kinesin K39
Pytve_DAOMBR484maker-pve_contig_86-snap-gene-0.45Conserved gene of unknown function

Sequence
2615 bases(100 bases per row)
CTGCAGCATGCCGAAAGCAGCATGCGCAGCGACAAGTCGGGTCGCAGCAGCGAGCAAGGCGGCGGCGACGACGACGACGGGTATGGCAGCAGCGACTTTG
AGGAGGAAGAGGAGATCGCCAGGTACCGCACTGCAGTGGACAGTCCACACATCATCTCGCAGATTGTAGACTGATGGCATGTTCGTGCAGTGACATTTCC
GAACAGGTCGAGTCGATGGCAGAGGAATCGATGGCCGCAGAGTCCGAGCAGGCGGAGGACGATCGCAGTGACGTGAATGGTGGCAAGGAAGCCATCACGG
CAGCCGTGCCTGCAGTTCTCCAGGACGATCGAGCTGTCGAGAGCGAAGACGCGCTGAATGGGTATGACTACATTGAAGACGTGGAGCGAGGGTGGTAACA
TCGCCCCCAAGCTTGATGTTTTTGAGCGATCATGCAAGGTCTAGTCCTCCTCGTCCTCGTCCTCCACGGGCTTCGCCGGCGGCTTGTAGTCGCTCCCCAT
GAACTTCTTGAGCAGCTCGAGGTCGTCGAAGCACTCGGGGTGGATGAAGTAGTTGCTGCCGCGCGCCTGGAAGGACAGCATCGGGTGCATGCCCGGCTCG
GGCCGCGCGACGTCCGAGATGAGGAACGAGCTTCGCTTGAGCTGCGCGAGCAGCGTGAGCGTCTCGACCGTCACCTCGATGTCCCCGTCGGCCTGCGGCG
GCGCGAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTACGGCTTGAAAAGCACGTGGAAGAGCGACGTGGTGCCCACGCCGAAGAGCATGATGG
TGCCGCACATGGCCCACTACAGATCGACAGCACAGCGTCAGTCTCCATGATTGTGTGTAGCCCTAATCTGTACAGATGTGTGGAGCCAAGCACACTCGTG
CATCCTTACCTTGCCGATCATGGACGCCGACTGCTCACTGAGCACCGTGATCATCGGCATACCCACCGACGTGAGCACACACGAGGTGACCGACACGCCC
TTCATCATCCGCACCGAACGCGCGAGCGGCGCCTCGTACGCGAGCGCGGCGTCGGCGGCGACGTCCGAAGGCTTGGCTTTGGCGGTGGACGAGGCCGACG
TGGAGCTCCATCGGCGGGCGTTGAGCGCCAGCAGCTGCACGGCCGGCTGAGCGGAGCGAGCACCGAGCAAATGACACGCAGCAGCACTGGAAGGCGATCG
ATGCAGCGCCGCGCGAGCAGCGGAGGCCGCGCCGCGGACCACTGAGCGGTGCATCATTTGCATGTCGAGTGTGGTGCTGGATGGTCGGTCAGCCGCACAT
TTACGCGAGATGGATGGCACCCAGTACTGTTTATTACTCGAATAGTACGCCTATGCTCTTTATAGTGGCCCTGCGCGTTGAAGTGCAGCTGGGTTCGGAG
GGTATCTGGGCCGGCGACGCCGTTCGTCAAGCGGGTGACGCGCGCCGGGCGACGCATGACGGATGCGATTGGGCCACGTACGATCTCTGGACGTGTCTCC
ATTGCGCGCACAGTCTGCACGTGTGTGTACAGTACTGTACGGATATCTCTCTCTCTGTGTGTATCTGTGCACCTGAACACGTTACCACCGAGCGGTCGCG
AGAGTGTGAGTGTGCGTATGTATGCGTGTGTGCACGCGCTCAATCACAGGCACGGGCCAGAAAAGTGAAGGTGCACCGCAGTCTGTCGACGAAGCCGTTG
ACGCGAGCCTTGCGGCCGATAGATAATCCTCCCCCATGATCACAACGGGTGTATATATGTACGCAGTCGGCCGCCCGACCACACAAAATGTGACCCACAA
AATGTGTACCTACCTTTGAGCGGGCAAGCTTATCTGGCCTGCAACAACCTGAGCCCTCGCCGGACACGTGGGTTAGCAAACGGTGCGGCCGATTGCTATC
CACAGCTCACAGCTGGTCTGTTCGGCGTGCAGCCGCCCCCGGCCGCGCCAATGCGGTCTGGTCTGGTCTGAACCGCCACCCTACGAAGGATAGCAAATTG
CTATCCTTGCCGCCGATGGGTGACGACCCATTATCGCACCGACGATATGGGTGTGCTATCCGTCCAGCAGCCATCCTTGCGGCCTCCCTTCGCCCCCGCG
GGCCAACACGCGGCAGCTTGCAATACTCACGGCGCTGTCGCCCGAGTTGCTATCTGTCGCGAGGTTGACGCTTTTTAGTCAAACGGATAGCAAAGCATTT
TGAAGTGGGAAGGTACGCTCGGTTATATTTCACATTGCGACCGGAGAGTGTAGAAAAAAGGAGCGGATAGCAACAGGGTCCTTCTCCCACCGTCGCATCT
CAAGCACGCACGCGGAATGGCCGCCACCATCTCCTCCCTCCGCCCGAGCATCCCCCGAGCCACGAGCCAGCAAGCCAGCCAGCCAGCCTCGGAACCAGCG
GCCACGATCGACCCGCTGCCTGTCGAGCGGCTAGGCTGTGGACTGTGCGAGCCGTGTAGAACACGATCCGAGTGGCGTCCGCGCGGTCTGCCGCGTTTTA
TACGGACGCGGGCCGGCGCATACCGTACACTTTACAAAATTGTGATGGAAAGACGCCGAGTGCGGAGACGGCAGACCGTTTCGTCGTGTGCATTCTCAAG
CTGAACGGGTGGGCG