Description :
From Genome Similarity Track
Location :
Scaffold_33:54302- 57027
Sequence
2725 bases(100 bases per row)
CAGGCGCAAGCGCCTTCTGGTCCACGAGAGAAGGATCTTCATATGGCTTAAGCAATTCAACGTATAACACTGGGTGTGTGCGCAATTTGCGCGGGAGGTT
GAGTGTATAGGCAAGGTCTTTTTTCGCTATGACCGTAAACGGCCCAATGGAGCGCGGACGCAATTTCGTCTTGAAGACGGCAGCCACTACGTTTATAGGT
AGGTTTTTTAGAATTTAGGAAGACTTGGTCTCCAACTTCGTAAGGATAAATAATCCTCTGCCCTTAGCATCGGCTTGTTCCTGTTGTTTGTCTTGGCTAT
CAGCCATTGCACCACGCACATGGCGTAATACACTAAAGCGCGTCGTGAAAAACTCGCTCACTTGTTTCTGCATAGTGGTAGCGCTGATTTCAGCAAGCTT
GTCAGCAGACTCTCCCCCACCAAGCCCAGCACCACGAGTGGTAACGTGAGCGGAACGCGGGGGTGCGTGAGGCTATTCACATAGAATGGAGTAAAGCCGG
TCGAGGCATGAACAGCGTTGTTCAACACAAATTCAACAACAGGGAGCATGGAGATCCAACGCTTAGGCGTATCAGCGCAAACACTGCGTAAAATGTCATT
AATGACGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGCTGTGAACATGTCCAAACGGGTGCCGATCACCTTGAAGATGGACTTCCAA
AACTTCCCAGTGAAGCGGAGATCTCTATCAGAGACAATTGCCACTGGCAAACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTGTACCTTCGG
CATCAATAGAGTCCGGTACTGCCGCGAGATGAACCATCTTGCTCAATCGCTCAACAAAGATCACAATGCCAGTGTTGCCTTCCGAATCTTTCGGTAGGCC
AAACACAAAGTCCATACTCATGGACTCTCAACACCCAGTGGGTAAAGGCAGACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGTTTTCACCCGTTGATAC
GTTTCACAAGTACGCACATAGGTGCTCACCCATTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTACAGGTCTTCTCACGACCGAGATGAC
TACTTAAAGCGGTATCATGTAACTCATAGAGGATTCGAAACTTCAACTCCTCACCATGAGGGACAGCGATACGAGGGTTATCCTCAATATATATGCGATA
GCACAACAGGCCATTATTGATAGAATATCGATGTAGCCTCTCATGTAAACGTACCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCAAGAGCA
AGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGTAGTGACGTGAGCAAGCTCATAGTCAG
GTCGGCGCGATAGCGCATCAGCCAAAACATTTTGATTACCTGGATTATACTTCACTCCGAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGCAATTAT
CTGAGAGTGATGCGGCGACTGTGTCGCAGTACGCAATGATGCATGATCTGTATAAATCAAAAATGGCTTTGAGCCAAGTAGATGTACTCTGAATTTGACT
AGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAACAGCTTTGAGCTATCAAGATTCGAATGCAATGACGCGTTCGCGTC
CATCGACATCTGTTTGTAAAATTGCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCGAATCTAGCAAAGCCAGTATTGGC
GCATGAAGGAGACTTTCCTTAACTGCTTGAAAAGCATCATGTTCGGTGTTACGCCAACAACAATCCACATCCTTCTTAAGGAGACTGGATAATGGCCGAG
TCATGTCTGCGTAATTCGCAGTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAAATCGTTTTGGTTCTTTGGAACCGTCCAATCGACTAT
GGCCCTTACCTTAGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAATGAAGCACCCCAGAAAGGGAATCTCTTCTGCACCAAAGATGCACTTAGATGCATTT
GCATACAATTTATTAGTGCGCATGCACTCGAGCACCGCTCATAAATGATCAATGCGATTATCCACATCAGATCGACTGGTCGTTGCACGACTATGGACAA
AGATGTCATCAAAGTGCGTTTGTGCATAGCCTCAATGAGGTCTGAATAGTTGCGTCACCAGACGATTAAAGTAGCCGGGGCATTTGACAGCCCTTGTGGC
ATAACGAGCTACTCCCAGATCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCGTATGAGCAGCTGGTAATAACCATCGACTAAGT
CGAGCGCACTGTACAATGTACATCCCACCATACTGTTCTGAAGAACATCCTTTCTGGGGATTGGTGTCTGAGCCGGGATAGTGGTAGCATTAAGCTTATT
ATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAATGTAGGTGTGGAATGGGGAGACTTACTCTCCCGCACCATTCTCGCAGCGTGC
TTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCGTTAGGTAAAGGCCACTGCTGTGTTACGCAGTATTTAGTTCCTGGAACTAGGTCAATTTCAT
GATGTACACCTCTATCGGGAGGTAA