Description :
From Genome Similarity Track
Location :
scaffold_2203:543- 1581
Transcript NameFunction/comments
Pl_100093hypothetical protein PHYSODRAFT_410641

Sequence
1038 bases(100 bases per row)
CACAGCTTCGAGCTTGTCGTGCAGTGGCTGCATCACTCGACTGTAATCCACCAGTGAGTCGCGCATCCACCCGGGTGCACACAGAAACTGCTGTAAGTCA
GCAGCAGCTGACGGGAGAGGTAGGTGGTGGAGACCGCTGACTCGCTCGGGACTCTGACACAACTGAACAACCGACCGCACCATTTGGCCTCCTTTTGAAA
TAGGACATTTTCACTGCACTAAGTTTCTGACCTCGTTCACGTACTTGAGTGAAGAAACGACGCAATGTTGCAATGAATTCTTTTGGCGAGCGTACAAATA
ACATTATATCATCAATCCAGATCAATAGTTCTGCAGGTTGCATGTCTTCAAAACCAACGCTCATCTGATTCTGAAAGTGTAGTGGTAAGTCCATCTCTCC
TTGTGGAACACAGGATGGCGTCCACACACCTTCATCAGTGATAAAGCTCATCTGATCCCGACTATCATCAGCGAGTGGCAACGGAGAAAACCCGCTAAGC
ATGTTACCCCGCAAACGCGTACTATCCAGCAACATTCTGATATGAGGACGTCAAGTCCGAACCTGTACCGGCGATCGGCACTGTTACAGCATTCACCGGT
CGGTAGTCAATACTTAAGTAAAATTCGTTTGGTCAGTTCACCTTCGGAACCGGCATAGCAACACATGTCCAGACGCTCAAATTGTTTTGACGAATGAATT
CCATTGTTTCTAGTGAGCGAACATGCTCATGTAGGAATTCACTATGTGCTGGAGATTAACACCGTGGCCGTGCTCTAAAAGGTATCGCATCAGAGCGGAG
AGTGATGCGTAGGGGTTCCTCCTTTGCAGGCGGGTCAGCGAGGAGATCAACTCGAAAAACGTCTTCATACTCAAGCACAATTTTCCTTAGAGTCCAAGTA
TCCATTGTAGAAACCATTGTTACCTGCTGCGACTACCATTTCCTTCAATTTCTCGTGAATTTCAGAGGGGGGTATAAAGTCAGGAATGCCTTAGCCGAGT
GGTCTTCGTTTGAAACAGGGGCCCAGCTGCCAGTTGTG