Description :
From Genome Similarity Track
Location :
Scaffold_59:54292- 55696
Transcript NameFunction/comments
Physo_137954hypothetical protein

Sequence
1404 bases(100 bases per row)
CGCGGCGTGAGTCGTACTCGGCCTGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACGAGGTTGAGCGCCAGCAGGTAGAAGATCGCCAGCAGTAC
CACGAACGGCACGTACGCGTAGTCGTTGAGCGCGTCCGAGATGTACGGGTACGACACGCCCACGATGAGGTTGCAGAGCCAGTTGATGCCGATGCAGAGC
GACGACGCGCTGGCGCGGATCGAGTCCGGGAAGATGTCGGCCGTCATGACCCACACGAGCGGCCCGAGCGTCACGCCGAACACGATCACGTACAGCGCCG
TGAACACGATGGAGAGCGCCGACACGTCCACGATGAAGGCCACCGTCATACCGATGGACATGACCACCATGCCCGCCAGGCCCCAGAGGATCATGATGCG
CGCGCCGAAGCGGTTGGCCAGCACGCCCGTGAAGAAGGCGGGAAAGATGTTGATGAAGTCGATGATGAGCGTGCCCACGCGCGAGTCCGAGATGCCCGCG
TCCGAGAAGATGCTGCCCGAGTAGTAGAAGACGGCGTTGATGCCCGAGAGCTGCTGCGAGCACGAGAGCAGGATGCCGCCCAGCAGCTGCAGGCGGTAGC
GCGGGTTGAACATGGACTCCTTCTGGGGCGCCGCGAGCCCGGCCTCGGCCGTCTCGGGCTTCTTGCTCACCTCGAGCCACGACAGTGCCGTCTGCACGTG
CTCCTCGCCGTAGAGCCGCGCGATGACCTGCTTGGCCTCGTCGGTGCGGCCCTGCGTGAGCAGCCACGCCGGACTCTCCACGCACATGGTCGGCGCCAGC
AGCAGGTAGACGGCGCCCAGAATGACGGGAAAGGCCGCCAGGTAGCGCCAGCCGGAGCTCGTGTTGGCGAAGAAGAAGGCGATGGCCGGGAACAAGATGC
CGATGGTCGTGAAGATCTGCAGCCCCAGGCCCAGCGTGTTGCGCATGTGCGGCGGCGACAGCTCGTTCACGTAGCTGCCGATGGTGGCGGTGGCCGTGCC
CGAGGCGAGGCCGGCGATGAGGCGGCCGATCGAGAAGATCCAAATGTTGGACACGACGGTCTGCACGACGCCGCCCACGATGATGAAGATGCAGTTGCCC
ATGAGCGTCTTCTTGCGGCCGTACTTGTCGCTGAAGTGGCCGCAGCACAGCGAGCCCACCATGGCGCCGAAGATCCACGCGTTCACGGCGAACGTCCACT
CGAGCTTGGTGTGGCCCGGGAACATGAGGCACGTACCCTCGGCCACGGGGCGCGCATTGCACTGGTCCGTGTCGTTGTACTGCGACAGGTTCATCTGCGA
GGTGGACCAACCGCTCTGGAAGGGCTGGAGCCACGACAGCAGCGCGCTCGTGTACAGGATGGCGTTGGGCTTGATGAGGCGCGCGGCGGCCTTGTTGGCC
TCGT