Description :
From Genome Similarity Track
Location :
Scaffold_779:5429- 7872
Sequence
2443 bases(100 bases per row)
CATCTTCGGAGCCCCGAGAGAGCATATCCAGCCCGCCGACGGGTACACAAGGTGAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGCCCCCCTCCGTT
AGTCGGTGTCTGGGCGCTGGTGGGAAGCTCGATCAGGCCTTAACCAGATTTTGGCCGATCCCGCTACACCACAATGGTGTGCGTGCCCGGATTCGAACCA
GGGATTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAAGAAAGAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCAACGAAGACGCTGCTGAACAAAA
CGAGATCCGCGGATCGACAGAGTGCTCGGAGGACTTCTGTCGACGGAATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCACA
GGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACCGAGATTCACTAACAAAACAAACTAAGGCGGGATCAGACCGATACGCGTTCGCCGACTCGCCG
ATCAGGCTCGATCCGGACTACCTGGACGCGATCGCGGACAAGGACCAGATTGTGAGGAAGAAGCTGAGAGCGCCAGGCCTGGACGACGAAAATCCCAGAC
CGTCGGCGCTCGACTGGTCCGAGGCTGACCTGGATCGTCAGTATCACTTGAAGGAACTGCGAGACTTCTTGCGTCAAGATCCCGTCATGGTGATCTTGCG
GCCAGAGCAGATCGACGACCCGAAGGGCCCGATCTCGGCCCCCCGAGTGGCGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGACTGTTGAAGGAA
GCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAATGATCTTTTCGATCAGGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGAC
CTTTGGTCGACGTGATCGCGGACAGTCCGGACCCGAAGGTGCCAGATCTAGTGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCG
ATCGTCGTCTCCTTATGTCTCCGCAGCGGAATACGTATCGGATACGTCGTCTGAACCTCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGAC
GCACGATGACGGAGTCAACGTCAGGAACGCATGCGATCAGGACCTCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTACTACCGGATCAGATG
AGTCGACTGGCAAACTGGAGTCTTCGCGGGACGTGGAGATGGAATCAGCCGGATCGCCGGATCAAGATCTCTCTCAGTAGGAATACAATCCGGACGACAT
TGATCTACCGAGTTCAGCCCCTGCTGCGGTGGCCACCGCTGCCTCAGGATCCACTGGGTCCTCATTGATCCAGCGTGGGCGGATTTCGGCGATGTCCGAT
CTTAAGGAGTTCAATGGCAAGGATCAGGACGAAGACCGCGGCCGATCGTGGATCAGCAAGGTAAAGTCGGCGTTCCTGCGAAATCAGACTACGGACGAAG
AGAAGTGCCTGACCTTTGCTGATCTACTGACGGGCCCGGCGAAGAACTGGTACCACCAGCTGGGCCGATCGACGCGGATCAAGTGGAGCGATCTACTCCG
GAGTTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTATTACCATTCTCGCAAGAGATCAGATGAATCGCCGTTGGAGTACCTCTAT
CGACTGAATGTGGCGGCTCTGCGTGCGAGATTGAAGATCAAGGACGGAGATTCCAAGGCCCGCAGAGAACATGTCGAACACTTTATCGAGACGCTGGGCG
ATCCGGAACTGGCCGATCGTACTCCGGCTTGCGGACGCAGAAGATCTGGAGGAAGTCCTACGCGCTCGAGAGCGCGCGATGAGCAGACAGAAGCGATCCG
CCTTTGGATCGAAGTATCGTCAGAAGGTTCCGACCTCAGCACCAGCTGCTGCAACCAAGCGGGCAGTGCGTGCAGCGCAGATCGCGAGCCAGGAGTCTGG
ATCGGACACGGGATCAGACGGATCGGACTCGGAGGGTGATCTACGTCGCGTTTACCTAGCGTCGACCGAGGACAAGTCCCGTAACGCTGGGGGCGACGCG
ACGAAGCCGGATCGAATCAACCAGGCGCAGATCAACCATGACCCACCTCGATCGGATCCACGATCGCGATCTTCACCTGACGGATCGGAGCGATCAAACC
GCTGCTCACATTGTGGATCGCGGAAACACACCGATCTCGATTGTTGGAGACGTTTGACGTGCGAGAAGTGCGGCAAGAGAGGTCATCCGGCGGATCGCTG
CCTGTTTGTGTGCCGTGGATGTGGTGAACTACACGAGATGGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGTCAATGGTTCAACCCGGTGAAG
CACGCTGGCATGTTGCCCGCGATCGCCGAGAAGATGTAAACTA