Description :
From Genome Similarity Track
Location :
Scaffold_116:54287- 56093
Transcript NameFunction/comments
Phymu_g4718myosin-like protein

Sequence
1806 bases(100 bases per row)
GTTGGGTTTCAAGCAACGCACGTAGTGGCAGTCAGTGACATTAATAGTTTCCAGCAGAGTCTTCAGCTGGGTACGGAATTGCAGACCCAGGCTCACGCGT
GCAGCAGTGCTCGAAGCACGGCCCTTCGTCTTTCTCACTGGAGTCTTCTTTTCAGGGGATACCGCCAAGAGTCCGCGCACAAATGGCTTAGACGATCGCT
TAATGATGGCAGTGATTTCCGGGTACAGGAtgtccttgttcttctcaCAGAATCCGAACGTATCGTACGTGACCGCACCAGCGTAATGGTGCACGACGAA
AAGATGATTGGCCATTTCTGTCTTGCTTGCGCTGAAGTGTGGATTAAGCTCGTGTTGACGATAGAGTTTTCGTGAGAAGTTCTGGTCGTTACCTTGCGGA
ACGATGCATTCCTCGTCAAGAGCCGGAAGAATGCCGTACGGCTTGCCCTGGATCAGGTCAATGCACGGGCCATTGTCTGGGAAATTGATGAAGCTCCACT
GAatttcttccttctcgtacgtctcctgctccatgCGCAGAACGGTGAggttgaagtgctgctgcagagtctcgTTAGCGTAATTGATGCACAGCTGCTC
GAAAGAGTTGTGCTCCAAGTCTTCAAACCCGAAAATATCCAAAAGACCAATGAACGGAACATCGCGGTCCTCGTACTCCACGATCTCATTGATACGGCTG
ACGAGCCAGTCGAATAGTTTTCCGTAAAGGAAACGAGCCAAGGCATCACGCGCGTTCTCGGCAGCATCTGGCAGCAGACCGATTGAGTAGTGCTCGTCCT
TAGTCTGGATGTTGCGGTTGCAAATTGCCTGTTCAAGACCATTCTTGTCCACCTCCAGgtagtccagcaccaccttcatcgaGCTTTCGCACATACTCGA
GATTTCGGACCCCTCCGTACCAGAAGCGTGGTGTGTCTCATCAAACTCCAGGTTACCAATATGCAACAGAGCAGAGATCGTAACGAAAATACtctccatg
tcgtcctcgtcgaaaCCCATTGTCTGCATGGCGTTCTTCAGGACACCAAACTGCTCCGCATCATTGACACCATCCTTACGCTTGACACATGTACTCTGGT
TGAGATAGTGGAACTTGGTAGGCGCCTTCAAattccagcgcttcttctcttccgCGGTGGCACCAGCAATAATTTCGTAGAAAATGTGGTAGTTACGCTC
CGACTCAGCTTGGTACGCGAGGCGCACCTTTTCCAGCAAATACGTCTGAATCGACGCGCCGATAAGACTTCCCTCCGTCGAAAACTCCATCTTGATAAAC
TTACCGAAACGACTACTGTTGTCGTTGCGGATCGTACGCGCGTTACCAAACGACTCGAGAATCGGGTTGGACGACAGAACTTGCTTCATCACGTTGCTGT
CGGCCGAGGCATTCTTGTGCTGTGAAATAGTCGCCAAGTAGTTCATCACAAACTTGGTGGTCTCGGTCTTTCCGGCACCACTTTCACCACTGACCAGAAT
GGACTGGTTAGCGGGCCCTCCATGCGAGCTTGTTCCGATCGGGTTAACCAGCGAACGATAGGCCTTGTCTGCGATACTGAATACGTGCGGCGGCATGTCT
GCTACTTCGTGTCCAAGTGCACGTTTGTCTCCATTGCGAATGTACTTGCGCGTGATCTTGTCCGTGTAGATGCCCAAGTTCTGGAAAGGATTGATTGCCA
GCAAGATTTCGCCCGTGAGCGTGTAAATctcgttgatcttgaagcgctcgttCAGCGTGTGGCAGATGCCGGGCTCATGTAGGTGCGGTAGCTGAATCAg
gtcctc