Description :
From Genome Similarity Track
Location :
contig_42:542842- 556740
Transcript NameFunction/comments
g7784.t1hypothetical protein

Sequence
13898 bases(100 bases per row)
CCACCTTGTGGAGTGGTCACCTGAATGTATCCCTTAGTGCATGTTACACTACGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAGTGAGACCCACCT
TCAACAATCGAGCGTTGTAATAGCAATTATGCCATACTCGCTGTTGTCGGATCCATGGACGTCTTGGTTGCGCCGATCGTGAATTTCATTATGTTTTCCT
TGATTGTTGCGGCAGGGATTTCCACGACGATCATGGCGTTTCCATTAGGAGAACGATTGTTGTTTTCACGACCATGGTAGTTGGTCCACGAGTTTTTTTT
GCCATGGTTTCCCTTGTAGCTGCCTTTGAAAGGGTAATGACTTTGCGTGCCTTGTGTTGCCTTGAGCAGGAAGAGCCGTGTCAGTCTTGATTTCGCCATC
ACGTAGGTGACGCTGCAGGATGCAGCGGTCGACTGTGTCGTGGTTGTCGCGCTGGCAGTACGTGCACTTCACTGAAGCCACGACAATTTTTTCATCTTGG
TGGGACTCGGAGATTCGCTGGCATCGGAATTGGTGATATGGCTTGAACAGCTCTCTCAGCTCGTGTTTACTTAGACTGGGGTTTCTTGTCCGAGGATGTA
GCGATTGCGCGCTAGCTCATTCTGGACCTTGGTCTCGACGTGCCGTTTCAGGTCTTCGTACGGAATAAACTTCCGACTGCCTTTCCAGACTGCTAGTTCA
GGCTTCCACTCCGTTGGGAAGGAATGGTACAGACAGAGCGACCTTTGGTCGTCGCTCAGCACACTGTTCGTGGCTTCCGCGGCTGCCTTCATAGATTCAA
CCAAGTCAATGATGAAATCCATCCTTCCTCGTATTTGAGGGCCATCAGGTACGGCTGAATGTAGTACGGGTCACTGCGGATGGCAGCAACTTCGTACTCC
TTATCCTTCACCACGAGAACGTGTTGATCATCGATGGTTTTGATGAGGAAGGCTTTAGCCTTTGCTTCATCGAGCCGTAGATTCCTCGAGCTCAGTTTTA
GGCTCTTAGCCTCTAGCTTCTCCGCTCGCTTCAGATCATCACGCTTTTTAGCAGTGAATGACTGGATCAAGGGTGGTTGTATCTACCCCATTTCCACGTC
GCCGTCGTCTCCAACGGTGGCAGACTTCGAACTTGAGTCGTCCATGTCGTTGGCCTTGGGTGCCCCAACGGCGTCTAGCGCGGCCTTAATGTCCTCATGT
CCGCCAATACCGGGTTGAGGTCTTCATCCGAGGAGAAGTCGTAGTCCTCGTCGCCCGCATAGTCGGCTTCGAGGGCGGCGGTCACTCGAGTGTTCCAGAT
CACGAAGTTCCGGCCACTGAGGCACGGAAAATCGTGGTCGTCGGTGCTTGAGTCAGTATTTGGGCTCATAGCCTGTCAAGGTCGTCGGAAGAGGAGCAGC
AGAGGTGAGACAGCTTATGTAACTAAGGTAAATTGGGCAACTTGGTAAATCCTACCTATAACCTAACCCCTCTTTCTTAAGACCCGCTTTTATGGGTCAG
ATTGGCCAAAAGTCGGGAAAGGCACAATACTTCGAGCTTGCACCCAAAGTGCTCTTGGTTTTTGGCTTTCCCATATTCCGTGTACTTCACATAAACTCGT
GTAGAGCTTGATACTTCTCCGCGGGGAATTATTGCAGAATGTACTATCCACAGACCCAAGACTCTTGAAAGGAATTGCAGTAAAATATGATATTATGTAG
GTACAACAGTAAGGAAGGCTCTCTCTCTCTATATTCGATCATACATCAATTACGACTCTTCATGAGAATGGCGAAGCGTAGCGAAATGCCTCTAAATCGC
ATGGTAACGATTGGGGGAGCTTTCCTAGACGGCGCAGCTTGTCCTCCGATGTGAGGAAGCTTGTACTCGTTCGAACCACCGGCGCGCATTGTACACTCGA
AAACCTTCTGCAAGGTGAGAAGATATTGTCAGCTTCTCATGTTCGAGTGCGTCGTACGATTTCCTTACCGCACGAATAAGCTGGTCGATGTTGTAGTAGT
CTTCTTGATACTGGAGAGCTTGTATCGAAGAGAAGTATCCCAAATCAAGGGTATATAATGGGAGTTTGCCGGCTGAAACTCGAGATGTTCATCGTGCACG
CCCAGCGGCGAGGATATCTGGATCATTGGGTTTGCAGTGAGATGTAGCATTATCATGTTGGATGATGATTGGCATACCTTTCTCACAAAATTGGCCATTG
GCCTTGATTGCTGGTATAACATGTTCAAGCAGGTAGGCTTGTAGACTTTACCATTGGCAGAATCTGTAGCGGGGTTACACATTCGGTTCACCTCCTACGT
AGTGTAACATGCACTAAGGGATACATTCAGGTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAAAGCATATGACTGGTAGAAAGTAACATCTTTCT
ACCAATGAGGGCCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTTATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAAT
CAATACAGTTCTCATTTGGCACCAAAACTATCGTTCGGTTCCTTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATAAC
TCCTACGCTTCCTCATACACGTGCGCACGCGTGTAAGCTTAAGCAGTGGGTCTAAGCAGACCCATTACAGAAACCAAGTTCTTCGTCCTGATCGTTCCTG
CCAGTCGGTTCTTGCTGGTGCGCTGCGCTTCTGTTTGCTTCGTAAAATCCCAGATGCCAATTTTCCGTCAAATAAAACCTGTCCATTTGCATCATATCTG
CAAATAATAAAAACAATAAATATCAGAGACTGAACAAAATTGATAAGTTGTGCAGGTTACGTTTACCTTGGTCTAGCTATTGCAGCCAGGAAAATTGTCT
TGCCGATGAATCGCTTGCTTTTACGCTCGCGATGAGGCACGGTCTCCCTGGCAGAACGTAGAAGGCCCTCTTGTTTGTGTCCTCGTTGAACCACTTCTCG
TCCACATGCACGACGTTGTACGGGGCGAGAAGTGGGAGCCATCAGATCCGTGGACCACGTGGCGAAGAGCGTGCCGAATTCGAGCATGCTTGTTCTCGTT
CGTCAAGAGCGGGTGGATGGTGTTGGTGTGGCGCAGGAGCTGGCCCTGCACGATCGCGTCCCACACCACAGAGCGCGCTACGTCCAGCTCATCTGCCAGA
CACTGTTGTGTCATGCGCCGACGAAACGGAATGGTGGTGATGCGCGCTAAAAGCGCTTGCCGGTCTTTCTTCTTGCGGCCGGCTGCCTCCGGCATCCTGC
TAACCACGCCGTCGATCCCGTCGCTGGCAAATGCCGACTTAAACAGGCCCCAGACTCGGCTAATGGTGCTGATGTCCACACTAAATTTCTCAGCAGCATG
GCTCATGGCTCCTCTGTCGGGGCGACCGTGCTCACCGTTCAGCAGTAGAAAAATCATAGCATCCTTTCGCTCTCTGTCGGTGAGGTTTGGCTTGGATGGC
GTGGTTCGGGCGCTCATGCGGGGGGACTGGTTGCTGGTGGCGTGCTTGCGAGATGGGGTAATTTGGGTAATGAGGATGCCCCATGCGTACACTTTCGCTC
GTAACTTTCTTGTTTGAAGGATTTTTTTGGCGCTCAAAAGACGCGCGAAAAGCTGAGAGCAAATGGCGTCGATTCCGCCTATCAGCGGGCTCAAAGCGAG
CCCATGAGGGAAAAAAGATCGGACATCTGTTTTTCGTTGCAATTATTTTCACCCAGAGGAAGTATGACATTACCTTGTCATACGTGTGTTCTCTACGTAA
TGTATCCATTCCGCATTTGAATGGAGACCAAGGCTCCACTATACTCCGCGACAAGATAAATCACCCACCTCGTTTGAGGGCACAGCTCTGTCAATATTAC
GAGTTAGCTATTGCTGTTTAGATATGCTTCTTCTGTCACCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCAGCGTGCGGGGGACCTCCAA
TACAAAATTCCATTTAAGCATAGCGACACATTAGATCACCCACTCGAAGCATACAAAAACCAAGTATAAAAGAATGACGGTAATTTCAAAAGTGCGTCTT
ATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGGCATGGACTCAATGAGTGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCTCAAATAAT
GCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCATTTGCATACACTCGCCTACTCATAATGGACCACAAATTCAAGAAGATAATGGAGTCCCAGA
TGACCTCGGTGTCCTTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGAGCGTGTTCACCATCTTGGTGTAC
ACCAACCAGTCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGACTTGAGCTGGGCAGCCGACAACATGCCCTTGG
TAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGTCGCTTGGCTTCTTGGTGTGGCGGTGTGGGCGTCGTGACGCG
TCTGATGGTGTGTGTGCAGCTGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCC
CGGTCTAAGGGAACCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTATAGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCAACTAT
AGTAAAAGCTAAACAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACCACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACAT
GGGTACACGTCGGTGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACACCTTATTCTCCAATCAGAAGGGAGAGAATTGGAACTCCCAAATTGG
GAATTCCCGGGCGCAGCCACAGCACGGCTGGCGCGCCCTCTCGACAGTCACGCAGTGACTTGTGTCCGTGGCGGACACTGCGAGGTGCTTCCTTGCACAA
AGGACGATGTCGGCCGCGAAGCCGCCGTCCTTAGCAACTCGTGTTGCAGTGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTT
GCGGTGGTTCTCCTTGACCACCTGCAGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTGACACTTCGTGTGTCTTGTGTCTCCCGTGTGGGTCGACACCAT
CCCGGGCATCACATAGCCCAAGAGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATGATAGCGGACCCGCATGGGTTACGCTAGTCATGGCTGAGCGCGTG
AAGCATCGGCGCCGTCAGGTCATTCGTTGACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGATACGACGGCTGCCATTAGCAGCCTGCTCATCACTAA
GAGCATTTCGGGTAGAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATAGACGCTTCGGTGTCGGACATCGACACCGAGGTACCCATCGGTACT
TGAAGCATGGTGGAGAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCGTGCATCGCCAAGACCAGGGCACGGTCGGAGTGTGT
GCAAGCCTGCACGACACTCGGTCTTTTTCATGACCACGAGGCGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTACCACTAGA
ACATTGAGATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCACATGACCGCGTCGGCGTACGGGGCTGTGCTCCCGTACGCCAGAGGTACGCC
GCGTGCTCAATGTACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGATGCTGTACAGTTGTTGGCTCATGCCAACAACAGCTTCCGTGAGGAAGC
TAGTCTCTAGAGACCTGGGAGGAGAGGTATTTCCGAACCCTCCCCCTCTTACGATCGATCCCCCTCCGGGGTGACCGAGTCGACCGCGGCTGGAATTCAT
CCAGCCCGGGAACAGTTTGAGTCTGTGCGACTTGACGTGGGAACGATATTACCCACGTCGGGTGAAGCCACCATGGGCTCACCTGGTGTGTGGAACTATG
TTACCCACACAGGAAGCGCAACCCGCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGCGCGATATACATTGCGCCAGGCACGACGTCAACCATGTGAC
TCGTGCCGTGAATTGAAACACTGGGTTCTTCGGAACCCAAGCGCAGCTTGCGCTTCGGCATACAAGGGTCAGCAATGCTGACACCTCGGCCTGGTAGCAG
CTGATAACCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGTTCATTGCGACTCCGGTCTGGTACGTGCCAGACCCGACTTTCG
GCGGCGACGGTGTCGTCGGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAGGAGTCTTATCGACTCCGTGTGGAATTACCC
ACACAGGAGGTGCTTATAGCAACCTCCAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGTAGTGCCACTCGGCACTACTGAAGTCGAAG
CCCGTACGGCGCGACGACTTCTCGGCGATGGTCGCTGTGGTATAGCGCAGCCACACATGCCGGGCAAGACGCCCTGTCCATCGGCTAAGCCTTTGGCGGT
CCGCGAGGGTTACCCGCGATGGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAACTACGTCAACAGAACTCTTCCAGGACGTTCCTGTCCAGAAC
AGAAGAAGAGTTCAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTACATCTCCCCAGCCTTCATGCTGCCTGGAAGTCGTGCAGCGACATTCCCTCGAG
GTTCAGAAACTCTGACACCTCCGGCAGGGCGGTCAAACTTATGACCGCCGCCTTGACCTGACAGGTCTCGCCGTCGAAGATGTGATAGCATCTTCGGCCG
GCCGTGCCTGAGGAGCGTTGATTACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTCAACAGACTCGGCTTACGGCGGCGACGACGTCGTCAATGCCTA
CCCCGGCGTGGTTCTTCGTTACCCACGGCCGGTGGTGACTCAAGGGCAGAGTCGGGAATCTCATCGACTCCGTGTGGCACATTGTTACCCACACAGGAGG
TGCTCTCGGCAACCTCAGCCCTGGCCACGGTCTCGACCGTCTTGGCCTCACGTGGACTTGTTCTACTGGGGAGCTGACATCCCCTGGCGCTGATACAGTC
GAGCCTGTATGGCGCCACGATCAGGAGCGGTGGGTGCTGCTGGCGTTGCAGCTCCCCTCGCTGGACTATTAGTCCTGTCCACCGGCATTGCCTGTGGCGG
TCCATTGCCCGCAGTGGACGGTGTCTCAACACCTGTTGCAGCTGCAACTACTCCGACGACTTCCGTACGTCGGCGGACGCCATTGCGTCCTGGTAATCCT
TTCGGATACCGTGTGTTCTGGCAGAGGTGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTG
CTTCAGGGTGCGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCGTACGTGTCCACGACCACGTACGGGTCGCAGCTGTTCAGGTATGTGAACCTGAC
AGCAAGGTCTATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCGGCGTACGAAAGCATTCGACGCCCCTGGAACTAAACGTT
CCTAGGGATATTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTC
CATGGTGTGCGCCACACCCGTCACAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTACTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTT
GCGCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTA
TAGCAGCGGACCGAGCCAAGCTCAGCAGAGCTCAAGTCCATAGGCTCTGGCTCGTTGTTCGCAACGACAAGTTGCGCAACAACCGGAGTACCAGCCTGCT
TATGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCC
GTCCATGAAGACCGTCGTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATGCCAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGC
TTCCCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGGAACGCATCGTTCGCCGGGAGAAACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATG
CAAAGCATCCAGGAGACGTCGTCTCCAGCGTGTACGCCCAATTCTTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGA
GATGAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGC
TTCGGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTGCAGGTTTCTTTTTTGTTTTTTTTTTTTTTTGTATTATACGGATTATTGTGTTACATGCTTTC
GCAGAACTCTAATAACCATGCGCGACTGGCCATTCCTTCCTGTCACGTGCATCACCTCTTCACACTCCGTCGCCTCTCCTCCTTCTTATAGCCCTCTGTT
TATTGTTTGTGCCTCATCGCACCATCTTCTTCCACCAGAAGCCGATGTCGTTTCCTTGTCTGCTATCCGCCCCAACGTACAGCTCATGTGTTCTGTATTC
CGTCGAGGCTCGCACTGTGATGCTCTGTTGTCTGTCCATGGCGTAATTGGCGATCCAATCCGCCGTCTTGTTGTGCTGCCTGTAGTGGTGACTCCAAGTT
GCGACCCCGCATATAGCCGCCAACCGTTTAGTGACTCGATACCAATGCTTCATCTTCTTCGATTTTGGTCTGTGCGTGTTCTTCATCCAACCGATGATAA
GCGCACTATCACCAACCACATGTAAGTTGCTCCATTTCATTTCGACCGCTTTGCTAGGAGCCTTTGTAGCCCGACAAATTCTGCCACGTTATTAGTCATC
GTTTGACCTCCCAACGCCGTCGCTGCTGCCCACAACAGTGTTCCTGTCACCTGTCCATTCGAGACTGCATCCCCAGTCAGCTCCACGACCACGCTACCAC
TTCCCCCGGGCCCTGGATTTCCCCGGGAGCCTCCGTCAAATAGGCCGATCCTCGTTGGGCCCGTCGGTGCTGTCAGTACCTTGCGCTCTGTTCCTACACT
CCAAGCTTTGAGAAGATGACCCGCCGCGGCAAGTTTGGGTTTCGAGTCCACCGTCAATGGATATAAACTCAGTGTGTAGCGCCTGCACGCTTCCAACAGC
CCTTTTCGTAATCCTTCTGCAGCCTCCGCTAGTGTGACCTGCTGCGTGCTTATCGCGTGCACGCGATTGACATTCCACCGCCAAATCGCTGTTACCGTTA
AGGCACAGCCACTAGCCCATATATCCTGTGCCATATCATTATTTTCCTCCCATTCCGTGTCTTGTTGTTGTATACCCCATTGAACAACCCAAGCCGGGAG
GCATTTGAGCCGAAACCCAAAAATGTCCTCTATCATGTCCGCCCTGAGCTGCTCTTGTGTACGTCCATCGTCCTCCCCGTTTCTCCACATGTGCAGCAGT
ACGTCCCAGAAAATTGCCGCCTCCGGGCATGTCCATATTAAGTGATCAGCTCCTTGGCGTGTGTCCCCGCACATTTTTCCGCCCTGCAATTGTATTGTGT
TTCCTTGTTGCACCACAATCTCAACCTCCCCCACTTTAGCTTCATCACATTCTGGACTTGATATGCTGGCACCCCTCCATCTTTTGAATTCGCCCCCACT
GCACTACGCATAGTGCGTCCGCTATCTGCTTGTGTTGCTTCCGCCACTTATCTTCTATCTTGTCGATCGCAATCTTCGCTTTATGCACACTACGCCGTGC
TAACAGTACTTTGAATTGCTTCCTGGTCATGGACCACCTCCTTTTGCCAGCCCAGAGTGGCCTCATTCGAGTTAACCAGGGGTGAGGGGTTACCCATAAC
CCCTGATCCTGAGCTTCAAGCCATCTCGCTGCCGCCTGGCTCACTGTTTCTTTCCCTACTGCCCACGGCACCTTCTTGCTGCTAGACCCCATGTGTGATG
CAACTCCGTGTCTCCCTTTCACAACCTCAAAACTATGGTGCTGGTCTTCTAGATGGTGATGTACTATCAGTTCCTCTGGTCGTCTTCCTTTGAACACGGT
CTCTGGATAGTTGGCTATAATGTTGCAGCATAGCTCCTTGAACAACTCTGCTACTTTGCTGTTCATTGGTATTTTGTGCTGCACTGGTCTGAAAATCACT
TGACCCATGTCCTTCCAATCTATGACTACCAGTTCACCTAATTTGACATGCGCAGGCCTGCTCACTAATATCGCCAGCTCTTGCCAAGTCATTATTCTTC
CTCTTAGATCCCACATTTTCAGCGCTCTCAGCTCCACCCCTTCCATTCCAGAGTGGAGAAAATCACCTCTCTCCTTTCTTCTTTTCCTCCTCACCTCATT
AATTTTGTTCTTGATACTGTCACCACAGTTGACCTGGAGCCCCTCTGCTTCCCACCGGAAAGTAACCCCGCTCGCAGCTCTCAGCTGCATCCGTATACCG
CGCCCTTCCTCATCCTCTTTGTTTTCGTGCTTCACTCCATTTGTCATCGCCCATTGCACCCATGGCCTCCCAGTACTCCAGAGATCATCCCCAGGTTCAG
TGGTGGGCTCTTTCACTTGCTGTGATATATGACCCTTCCACTCTCCTCCTCGCTGTTGCAGTAGATCGCCAGTAATCTGCATCAATGTGTTATCCGTCAT
TGCCCATGTCGCCACTGTTGTCGCGCTCATCGCTACTAATTCAGCTTCAATATTTGGCAAACCAAGACCTCCCTGTTTTGCTGATCGTTCCGCCAAGTCT
TTCTTGATCCATCCTGCAATTGTGGAGTCTGGTCTAGCAAAAGATGACTTCCATACAAAATTTCTTATCCGTTGATCTGCCTGCTTGATCACGTAACTCG
GCGGCCAAGCGTGCCTCGCAACATATAGCAGCTTGGGCACTATAATTGCTGCTGCGATTGTTGCGCGCTGCTGTGCTGTATTTGTTTTCTCCTGTGCCAG
CGCTAACCTTACTGTAATTGCACGGAATGCACGATCCCATGCTTCGGATACTGTGTTACCTGTTCCTGCGAAATGCCCCAGGTACCGTGCTGTGTCTACT
TCCGTAACCACCTGTTGTGTCTCCACTGCTGCAGCCTCGTCGTCTTCATCGTAGTGGAAATCCTTCTCCGATCCTAACCGAATCGCTACTGATTTGCGCA
CATTCAGCATCAGTCCCGAAACTTGCGAGAAGCGGCCAACGGCATTTATTGCAGCTCTCTGCATTGCTTTGTTTGCAATATAAATTGCCGTGTCATCGGC
ATACCCAGCTACCCTTAATTGATGTACCAACTTGCTGCTCGTTAAAGGTATTCCTTGCAAACAAGGGTCCATCTCCACTTCGTCGTAAAGTAGGTCCACT
GCGATGATAAAGAGTAGCGGTGCCAACGGACACCCCTGGCGGATTCCGCTTGTTACTCCGACCTCCCTCGATAACTCGCCGTTTGCCAGAAACCTTACTG
TGGTGTTTGTGTGAATGGCCTCCACGATCCTACAGAATTTTTCTGGGAAGCCTTTAGCTTTTAGTACAGCATAAAGAAATTCCCTGTCTAAGGAATCATA
AGCCTTGGCGAAGTCCAGCATCAATACTTGTGCTTCTGTCAGCTCTTCCCCATGTTGGCATGCGTGCTTAGCTGCTTCAAACAAATCGATCGCCTCATGG
ATTGTCCTGCCGGGAATAAAACCGAATTGTGTGCTATGTACTATGCTCGCAATACGTTTCCTCAGCCGCCACGCTAAAATCCTCGTGAAAATCTTATAGT
CTGAATTCAACAGAGCTATAGGCCTGTAGTTCAGCGGGTTGCTTGCATCACCCCCTTTACTGATACTGAAAATGAAGGCCTCTACGAAAGATTTCGGTGT
GACTCCTTCCTCCATGGCACTGTTGAAGATTGTGAGTAAAACTGGTATCAACTCCTCTTGATTGTCTAAGTACCAGTCGTTGCTCAGTGAGTCTGGGCCG
CATGCTTTTCCGCGCTTGCATTTTGCTATAGACATACTCACTTCCTCTGCTGTTATCGGTTCATCCAATTCCACGAGATCCACTTTCTCCCATCTGTCCT
GTACTCTGTTGATGTAATTTCTCTCGTTTGATCGACCTCCGCCGCACCATTGAGAATCGGTTCCCAGCTTTCGGCGAGAATATCCGCTTTTTGTTGTGCA
TGCAAAGTGGAGCCTGCTATTGTTGACTGCAAATGCGGGATTGTATTATCTCCGTACTTCGTGCATATTCGTCGATAAAATTGCTTCGTCGTTCTTTTGG
AACTCCAAGCATTGCTGGCAACTAGACAGCGACGTCTTGAAGCACCTCTTTCCCCTTGCACGTTGGCCAATTCATCCCAGTAATTGTTGTCTATGCAGCT
GGTGCTCCGGTTGCGTATATCCACACTTCCCCAATTTGATCTTGATTCGTCTTATTCGTTGCCTGAAGCCTCTTGTTGTTCTGCGCCTCGCCTCTTTTTT
AGCTGCGTCATTTCTCCTGTTAGCTCGCGCTTGAATTGATCCCACTTGACCACACTGCTTTCTTCACCTCCACTCTGTATTATGCCGCCAGCTCTCTTAA
CTTATACTCGATCAAACTCTTGGTGACCGTTTCAGCGTACGGCGGCGGTGGGTAGAGTTTTGGCCTCCGTCTGATCCTGACTATTCCTCTGGGTGAGTGG
AGCTCTAATATTACCCCTCTGTGGTCCGCTTGGCAGAAGGACTCCACTACTTGTATTCCCCGCAACATTTTGCGATCCACAGCGGTGATATACCATCGGT
CTATTCGTGATGACCCGATCATTCCATCTGCCGCTGGTTGCTTGTGCGTGTGATACGTGTCAGCATATTTCCTCCGCTCACTGTAATTGTTTTGTGGAAT
CGTGTAATTTCCTGCATCTTCTAGGCCATTCAGCTGAATGACCTGTTCAAGCGCTCTTGCTCCCATGTCATCTCTGTTGCAGTTTCCAATTCTGTCTATG
TTCACGTCGAGCACACAGTTGTAGTCTCCTCCCATATCATCGATATACCAATCGGGAAAGGTATCCTTCGTAAATTGTTGAAAAATGCGATCCTTGCCGG
CCCAGCCGATGGTGCATATATGTTTAGGAAAAGAATGACTTCCCTCCAATGATCCCCACTGCCATCATGAGGTGCTCGTTCCAGTACTCTGTACCCCATT
CTTTGACTTCCTTGACCGCTCCGTAAGGATTGACAAGTATGGCTACCCCAGCCCTTCTATCGGCCCCGGACGACCACAGCGAGTACTTATACGCCGCCGT
GTGCTTGTATCCCCACATTGCTGCATACTGTTGCGCAGCTGTCGTGTTTTCTTCTTCCCTCAAATGTGTTTCTTGTAAAAAAAATCAAATCTGTTTGC