Description :
From Genome Similarity Track
Location :
Scaffold_1385:5428- 7265
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1385-snap-gene-0.2Myosin

Sequence
1837 bases(100 bases per row)
GGGATTGAAGACATGATCGCGCTCAATTACCTGCATGAAGCCGCCATTCTGTACAACGTGAAGAAGCGGTTTCTCAAGAGGTTGCCGTACACATACACGG
GAGATATCTGTATTGCTGTCAACCCGTACCAGTGGCTTCCTGAGCTTTATGCCGAGGATATCCATGCCCAGTATCTTACGAAAAATCGCGATGAGCTGCC
TCCTCACGTGTATGCGACGTCTGTCGCGTCATACAACGATATGAAGCGCAATGCGATGAACCAGTCGATTTTGGTGAGTGGCGAGTCCGGCGCAGGCAAA
ACGGAGACGACAAAGATTTTGATGAACCATTTGGCATCGATTGCCGGTGGACTGAACGATACCACGATCAAGAAGATCATTGAAGTCAACCCGCTCCTGG
AATCGTTCGGCAATGCCAAAACCGTTCGCAACGACAACAGTAGTCGTTTTGGGAAGTTCACGCAACTTCAGTTCGACAAAGCTGGTATCCTCGTCGGCGC
CAGGTGCCAAACGTATTTGCTCGAGAAAACGCGTGTGATCCACCATGAATCACCAGAGCGGAATTATCACATCTTTTACCAGATTTTGGAGTCAACCAGT
GCCCCAAAGTGGTATTTGGACAACTCCAAGTCGTACACGTACACAGGAGACAACACAGCGATGAAGATTGAAGGCATCTCAGATGAAGCCCACTTCGAGA
GAACAAGAACGGCACTTGGACTGATCGGACTCAGTTATGAAGAGCAGGAAGTATTGTTTGAAGTACTGGCGGGTATCTTGCATTTGGGCGAAATCAAGAT
TAACAAAAAGAACGGAAACGACGAAGAAGCTGTGATCGCTCCGAATGATCCAGCGGCTGCATCGACCACAGCGCTGTTTGGTATCTCAGTTGAAGACCTC
GAAACTGCGTTGTGCTCTCGAAAAATTGCTGTGTCTGGTGAGATTCTGAAGAAACACCTTCGTAAAGAGCAAGCCGAAGAATGCCGTGATGCTCTGGCAA
AGGCTACCTATTCGAACATTTTCGATTGGCTGGTGTCTGTCATCAATGTCTCGCTTGAGAATGACAAGAAGATGTGTAATCACGTGGGTATTCTCGATAT
TTTCGGGTTCGAGCATTTCAAGCACAACTCGTTTGAGCAATTCTGTATCAACTACGCAAACGAAAAACTGCAACAGAAGTTTACGCAGGATGTGTTCAAA
ACTGTTCAGCTTGAATATGAAGCCGAAGGAATTATCTGGAGCCACATTGATTTTGCAGATAACCAAGATGTGATTTCGATCATTGAAGACCGACTGGGTA
TTATTTCGCTGCTGAACGACGAAGTGATGAGACCGAAGGGAAATGATGAGTCGTTGGTGTCGAAGCTTACGTCGATTCACAAGGAAGACAAACATGTGAT
TGAGTTCCCTAGAACGTCGAGAACCCAATTTACAATCAAGCACTATGCCGCAGCAGTCACGTACGAATCGTTGGGCTTTCTGGAGAAACACAAGGACGCG
TTGCTTCCCGACCTCTCGGATTTGATGCGCAGCTCATCTAAATCTTTTCTAAGCGACATTTTTGCAGCCAAGGGGAGTGAAGCTGAAAGTAGTACGGCAA
AATTGCCTCAAGGTGGAAGTGCCAGAAGAGGAGGAGGGCGAGCAGCTGGTGGTGCGCTGTCAGTGGCGAACGTTGGCACTCAGTTCAAGGATAACTTGAA
TGAGCTCATGACCAGCATTCGTCAAACCAAGGTCCACTATGTGCGCTGCATCAAACCAAACCAAAAGAAGAGTCCCCATGAGATGGATCAGCCTATGGTC
GTGGCGCAGCTGCGGTGTGCTGGTGTGATTGAAGCCA