Description :
From Genome Similarity Track
Location :
Scaffold_139:54263- 56260
Transcript NameFunction/comments
Phyci_14921myosinlike protein putative

Sequence
1997 bases(100 bases per row)
GGCGCCGAGGACATGTGCGAGCTGGGCCACCTGCACGAGCCCGCCATCGTGTACAACGTGCGCGAGCGCTTCTTCGCGCGCGAgccctacacgtacacgg
gcaagatcgtggtggccgtgaacccgtaccagtggATCAAGGAGCACTACTCGGAGGAGCTGCGCGACCTGTACACGCAGCGGCCGTGGGACGAGATGCC
GCCGCACGTGTACGCGACGAGCGCCGAGGCCTTCCACCACATGAAGCAGCACCGCATCCCGCAGAGCATCCTCGTGAGCGGCGAGAGCGGCGCCGGCAAG
ACCGAGACCGTCAAGATCATGATGGAGCACCTGGCCAGCATCTCCATGGGCATCGCCAAGCGCCTGCACCCCGCCGAGAGCGGCGAGACCATCGTGGTCG
AGAAGGtgctcaagagcaacccgctgctcgaggccttcggcaacgccaagaccatccgcaacgacaactccagccgcttcggcaagttcacgcagctgca
gttcaacagcgacaactgcctcgtgggcgccgagtgcaggcactacctgctcgagaagtcccgcgtcgtggcccaggccgcaggcgagcgcaactaccac
atcttctaccagctCGTGAGCGCCAAGGAGGACGTCTTCGGCTTCAAGGAGGACACGTCGCCCAAGGAGTTCCGCTACCTGCAGGACGAGAAGCTCATCC
TGGACGGACAGACGGACCTGGAGCGCTACCAGGTCACCCGCGATGCGCTGACCACCATTGGGCTCAGCGACAAGGAGCAGAACGAGCTGTTCAGCGCTCT
ATGCGGTATCTTGCGTCTGGGCCAGCTCGACTTTGTCCCGCTCGAGTCCAACAAGGACGACGCTAGTCAGGCAGTTGCTGCCGCTTCGGCGTCGGAATCC
CTCACGGCCGAGCAGATTGAACAACAGAAGAATGAAATCGAGCAGTGCGCGAAGCTCCTGGGCGTGGAGGTGGCTGCACTGAGCAAACAGCTTTGCAGTC
GCACGGTCAAGGCGCGACAGGAGGTGTACTGTGTACCGCTGTCGGCTTTGCATGCTGGCAACAACCGCGATGCTTTGGCCAAGGAAATCTATGCGCGCGT
GTTTGGCTACTTGGTGCGCCGGGTGAACTACAGTATTTCCAACTCGGCGGATAGAGCAGCGTCGACGCCGTCGTACCTGCAcatcgacctgctggatatc
ttcggcttcgagtctttcgagcacaacagcttcgagcagttctgcattaatttcgccaacgaaaagctgcagcagaagttcactttagatgtgttcaaga
cggttcaggaagagtatcagcaggagggTGTGGCGTGGGAGTTTGTCAAGTACCGCGACAACCAAGATATGCTTGACCTGCTGGAGAACTCGATGGGTGT
GATGGCGCTTCTTAATGAAGAGTGTGTCCGCCCCATGGGCAGCGACCTGTCGTTCGTGTCCAAGCTGGTGTCACTGCGTGAGTCGCACCCTCGCCTTGAG
CGAGCCCGTCTGAGTCAAATGCACTTCATGCTGCACCACTATGCGGGACCGGTAACTTACGACGCGGAGGGCTTTGTTGAGAAGAACAAGGATTCTCTCC
AGACTGATCTACTGGAACTTCTTGGCACGAGCTCGAATGGTTTGATGTCGATGGTGTTCAGCGATGATGACAACACAGCCTTCATGACGGACGCAGACCT
GGCTGTCCGAGCCGCAACCATGATGGAGACTGGCCGACGTAGCACGGTCAGCCGAAAAACGTCCACATTCATGCAGGAAACGGTGAGCTACAAATTCAAG
GCACAGTTGTCACTGCTGATGAGCGACATCTCCAGTACCGAAGTGCACTACGTACGCTGCATCAAGCCTAACTCGGAAAAGAGCCCAAATAGCTATGAAA
TCGATGCGGTGGTGAGCCAGCTCCGTTGCGCTGGTGTCGTTGAAGCCATTCGTATCACTCGTGCGGCGTTCCCGAACAAGATGGCTCATGAAAAGTT