Description :
From Genome Similarity Track
Location :
Scaffold_469:5426- 7528
Transcript NameFunction/comments
Phypl_g8622hypothetical protein
Phypl_g8623sugar phosphate exchanger, putative

Sequence
2102 bases(100 bases per row)
cgtgcgcTAACGGATTGGACCGACACTGGAAACAAGAGAAGGCTGAGGGCCGAGAAGGCGATagaagacgacgacaaggccgAAGAGAGAGGAGCGCTTT
CCAGCCTGACTACGAAGCTTAAAAATCtgttgaagtcgaagaagttgcCGAAGGTTGCGCCGAAGGTTGATCCGAAAGTTGACCCGAAGGTGTTAACGGA
TGCTGCGTCGATGCAGAAGGAGTTGGTGAAGGTTGCGTCGATGCCGAAGGATATGAAGCTCCCGAAAAAGCTGCAAACGATGGCGCGTGATCAGAAGTCC
ACGGACGATGCATTCTCGACGTTGAAGCTTGGTGAAGAGGGCGCGAGGCTCTTCAAAGCCGATGCTCTGCCAGCGTATGTCACATTCAGCCAGCTTACTG
TCAAGCAGAGGGGAGGCCAGGACATGTATGGCGTCGAGACTCTTTTGAAACACTttggaaaaaaaaatgtgATCACTATTGCCAATGCTGGACTGAACAG
CAAAAGTGAGCTCAGTGTCGCCACTGCGGACCGATTGCGAGCTGGGCTGATCAGTAAGTGGTGGGGTGAACGCAAGTCGGTGCAAGACGTCACGCTGATG
CTAAAGGATGGGGAGATGACACTGAGCCAAGCCAACAGGGAGGTGATGAAAATATATCGGAATGCGTACAACAAGGCCTACATCACCAATGTTGCTGTTT
AAGCGCCGATAGACGAAGCTAACGGAGGTGTTGGACATTTTGTCAAACAAATAGAATAAACTGCGTTGCGCTATGAAGTTATGATGATGAGATTACACTT
TATTCAGGAAGCCCTCTCCCCCGGATGTAGGGCTCCCTAACTTGTCCCTCCGGATAACTGAACTGCTGGTGTCGTGCTAGTTCTCTCGAACGCAGTAGTG
ACGACGGCTACGGATGAGCACAAGTTCGTGGtacaggagctgcgcgaggcaCACGCACGACAGAACGGTGCCGACCTCTAGCAGCACAAATACTGGACCC
CACGAGCAAACCTGCACGCAGCGGGGGCTCTTGGGGTTGCAGCCTTTCGGCTCGTACTGGCAATTGGCCAAGTATCCCACGAGGTATTGCACGAGGGCGG
CACCGACGCTTCCAGTTCCATCGATGATACCCGTGACAGTTGAAAGTGCCTCTGCGTTACCTCGGATGCTCTCATGGGTACCTAGATCCGCCGAAATGGC
GGTGCTGATCAGGTTTGCTGGACCACCGAGCATGAATCCCGACGACAGTAAAAGAAACGCGGTCACATCGTATGAAGCGCCGTCCATGAAGTACAACGTG
ATGCTACAACATAAAACTAAAAGTTAGCATCCAAGCTCTAACAAATGGGAACTGAGACCGTACcaggagaagagcagcatAGTCACGACCACTGGGGACC
GCACGCCCATTCTGTCGGACACAATCCCGCCGACAAAACCTCCAAAGATTTGCCCAGCATCGTACAGCATCTACTTGTACACGATTGACAGAGGCAGTTT
ACGGTCAAGCCATGCCACTTGTGCAAATAGCAATCACACAAACGGATGGACGAACCGAGAACGAGTCAGCCTGGGAGTTCTCCATGTGGAGCGACACTGT
CAGGTAGAACGGAATCCAGAAGAACAGTGCGTAGTTGACCGACTTGAGGCAGGCATACGACATGGCGTATGGTAGGACCTGTTTGTTAACAAGGTAACAC
ACATACGTACACACGCGTAAGAGGAGATGAAAAGTAGCAccaaataaaaaaaaacaataCTAGCACTCACTCCAGGGATGCACCAGGCCTCCAAGAAGCC
AATGCCCGTCGCTTTTTcttcctcggcctcggcgccttcttccgGGTCGTCTTTCATCTTGGCCACTTCGGgcttcgcctcctccagcgttTCGTGGCGG
TAGGGCACGTCCTTCGGGTCCGGATACAGGAAGAAGTGGATGAGCACGCCATGGAACGCCACGAGCCCTGCCGACACGACGAGTGCGAGTTTCCACGCCA
CCGTCTTGTCGAACAGAGCAAACGTCACGGCCACCAGAGCGGTGCCCGCAATGTTGCCCAGACAGGCATTGCCGCTCCAcacgccgaggacggcgcccCG
CT