Description :
From Genome Similarity Track
Location :
Scaffold_222:54255- 57488
Sequence
3233 bases(100 bases per row)
CCCAAGTGGCCTTTTCCCTTTCAAACCTGGGAGGTCGGGCAAGGGCGTGGGCTATGGCCAAAGAGACAGCCACTCCGGGATACTTTGTCTCGTGGGAGTT
CATGGCGCAGGAGATGCGTCACACATTTCTCCTGGCCAATGTGGCGTACCGTCATCGGTCTTCGTTCTTGCGGAGAGCAAGGCAAGAGGTCCTTGCAGGA
CTATGTCATGGAGCTTCAGAACTTGGAGGCTGCCATGGCAGGGGCTCCGTTGTCGGAAGAGGTGAAGGTCACCGTGTTTATGGATGGTGTCCGGGTCGGA
CCCGTCCGCACGGAGCTCTTTCGTCGTCAAGCGACCACGTTCAATGAAGCGGTACATATCGCTTTGTTGTAAAGTCACTGCATGCGGTCGGCCCAGGGCC
ACGTCGGGGCTACGGAGGCCTCGGATGGTTCTACCCCCATGGATTTATCGTCGGCTGAGAAGACTCGCCCACGTTAAGGTGCGTGAAGGGCCGGTGGCCG
CTGTTTTGGGTGCAATGCGGTCGGGCATTACCGCAGAGATTGTCTTAAGAACCCGTGGAAGGTTGTCCACGGCAAGCCAGCTTCAGCGAAGCACTCTCTT
AACGCCGTAAGCGTTGTAGATTCGGGAAACGTCGATTCCCAGTAGGTGCGGGACGCCCTACTGGGAAGTCAATGGCTTCCAAGACGGGAGAGAATTTACC
CCCTCCTCTTCCTGGAGAAGATGTCCCGGGGACAACACTATTGTGTTTGTCTGTGGCCGCGGTGCGGTCAAACTTAGTGGTGGTTACTGCTAGGGTGAAT
GGGTACGATGACCCCATGACGGTCTTGATAGACTCAGGCGCGTCATATAACTTAGCGACGAAGGCTAGTGTGTCGAAGAATTGGGCGCTGTATACCAAGG
CTGTGGAAGACTCCAAGAGTAACAGCAAGGTGTCAGTTCGCTTAGCGACAGGATCGATTGTATCGAATCGCAAGGTTTTGATACCTTTGGTAATCAAGTT
TGATGAGTTTGATTCAGAAGAACCGTTCATCGTCTTGGACATGGACGATCGATACGATCTTATCTTTGGTTTATGAAGCATAAGCCATGGATCGACTGGC
TTAGTCGCACCGTGGGTGCTAGTCACAAACCCCTTGTGGAAAGAGCTTTCGCGGGTCATGTCCCCTCCTTGTCTCGCGATGGATTTGTGCACGAACATCA
CATCCCACGTTTGGAGAGCCTCTTTGCCGGTTCGGCAGAGGCAATGGGTGAGCAAGGTTGTCGCGGATCGACTGATACCTTGGAATGCGTTGAGGCTGGA
GCAGCCTCCGCACGAGAAGTCACAACCGTGGGTGGCGATGGAAGGGGTAGTGCTGTGGTCACTATCGCTCAGGAAGTCGCAACCGTGGGTGGCGGTGCAA
ATGGAAGTATTGTGGTTACTTCGGCTCAAGGAGCAGGTGTCTTTGGACGACATATACATGAAGTAGTTGTGTTTCCTCCTTCATCGGAAGACGCAACCGT
GGGTGGTTGTGCGAGTGGTAGTGCTGCGGTCACTATCGCCCAGGAAGACGCAACCGTGGGTGATTGTGCAAGTAGGGGTGCTGTGGTCACTCCTTCACAG
GATGTCGTGGTCGTAGATCGAAGCAGCTTGAATGTAATTGCGGTGGAACCGCTTACCAAGCTCGAAGAGTTGTACGGGATTGACGAATTGTCCCATCGGG
AGTTCCTAGCGACCCTCAAGGAAGGTGCGTTAGAAGATGTGGTGCTCATACGTCAGGAAGCGACGTCAGTGGAGCTGAACAGTTCTTCGGTCATGGACCC
AGAAGTGTTGGATGATGAGAACAAGTCTTATCGTCAGCAAAGGTATGGCTCGGCCATCTTGAAGAATCCATCGGATCCGTTTTATCCGCTGCTAAAGGAG
TTTGCGGATGTGGTCTCGGAAGATCCTCCGTCAGTGTTGCCCCTGGATAGCGGTTTACGGCATGAGATTGACCTGGAACCGGGTACTAAGTACTGTACTA
CGCGTCAAAGGCCGCTGCCTAAGGAGCAAGTGGACGCAATAGATGCGTTCTTTGCGGCAAATCATGCTGCGGGCATGGTTCGAGAATCGAAATCGCCATA
TACGTCCCCAACGTTCTATGTGCGGAAACCCAATCGGAAATGGCGCATGGTGCATGCTTTTAACAAGCTGAATGTGGCTACAGTTCTGGCTTCGACGCCA
ATTCCCCGCAAAGATGTGTTGCAAAACAGTATGGCGGGGTGCAGCATCTTTAGCGCGCTCGACATGGTCGACGGCTATTACCAGCTGCTGATGAGGGAAT
CGGATATTCCCCTTAAGGCAGTGAGTACTCTCAGTGAGATGTTGTGGGAATGGTTGGTCATACCCCAAAGGCTTTCCAGCGCGCCAGCCACGTTCAATCG
GCTGGTTACCCAACTGTTTCGGCCGATGCGACACTTCGCGCAGACGTATTTTGATGACATCTTGGTCCACAGCAAGGCTGAAGGGGACAAGACGGATGTT
GAGGTGCATATTGAGCACCTTCGGTCAGTGTTGATGTGCATGCGAGAGAATCGTCTCTTTGCGAACATCAACAAGTGCCTCTTTGGGGCGGAAGAGATTC
CCCTTTTGGGATGTTTCCTTGGGAAGGATGGAATTCGGGCGGATCCAAAGAAGGTACGGGCGATTGCGCAGTGGCCGACGCCCAAGTCCCAGAAGGATCT
GCGCAAGTGGCTGGGACTTGCAAATCATTTGCACAAATACAGCGAGAATTATGCTGAGATGGCCAGGCCATTGAAAAACTTGCTGAAGAATGACGTGATA
TGGTCATGGTCGGGAGAGGCCCAACAGACTTTTGAAGCCATCAAGATGAGCCTACAATCAGCACCAATTTTGGCGTTACCGGACGAGGGTCGTCCGTTTA
GTGTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGTTGCTTCAGCTGGATGCCTAGGGCAACGAACGTGTGATTTTGTTCCAGTCGCGGCAGCT
CAAGGCCACCGAGAAGAATTACCCAGTGCATGATAAGGAACTTTTTGAGATGAAGTATGCACTGGTCAAGTTTCGGGTTCATCTGCTAGGCAGTAAACCG
TTCGTTGTCTACACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTTTCGCAGCGCATGGGGCGTTGGTTGTCATTCTTTGCGGAATACA
ACTTCACGGTGGCTTATAAGCCACGGAAGTAAA