Description :
From Genome Similarity Track
Location :
Scaffold_274:5424- 7284
Transcript NameFunction/comments
g11108.t1hypothetical protein

Sequence
1860 bases(100 bases per row)
TGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGATAGAACGCTTCGTGATGTTTTGGATAA
CGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCCGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGAC
GCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCAGGGCTGCCACCTCCGATAGTGCTGCTG
AAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATTAAGATTCCACGTGACAT
GCTCATCGACAACCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCG
ACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGC
GGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGTGCTCAACTCCCTGAAC
ATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACAC
GCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACTATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCAT
CAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAA
ACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAGG
CGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACACTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGT
GGATGCATATTTTACGAAATGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGCGGTT
TGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTT
CGCACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCAGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGC
ATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTT
TGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTT
TTGATACAAGTCTACTGTAAAATATACTGATAAAAACATAACCCTGTCATAGTAAAAACAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAA
CCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAAC