Description :
From Genome Similarity Track
Location :
Scaffold_1:5423570- 5444704
Transcript NameFunction/comments
Physo_478207Hypothetical protein
Physo_472393polymorphic outer membrane protein
Physo_310711Hypothetical protein
Physo_310695Hypothetical protein

Sequence
21134 bases(100 bases per row)
GATTTTATTCTGCCAGGACCTCCACAGGTCAACCTACTATCCGCTTCAGGAGGATGCTTGAAACTGGGGCTCGAGCCGCCTGCAGGAAGTGACTCGACTT
CAATTCAGTATTATGTCGTTATCTCTGGTGTTACCGATGGTTTTCAGACAGCGTACAACGTCAGCGCCAGCACTCTTGTTGCGTGCGACCTAAACCACGA
CACGACTTATTTGGCGAGCGCTGCAGTCAGAAGTGCGCACGGAGTCGGAGAAAGTCAACTTGTGAATGCTGCAACTGGGGCGCTTTCAGGTCCAACCGAA
GTGCTTGGGTTGCTCGCAGGGGTTACAACTAGCGGATATTCGACGCTCTCTTGGACCGCTCCTCTCGATAAAGGTGGAATGCCCATCAAACAGTATGATA
TTGCAGTCACGAACCAAGCGACGAATGAAGTCCGATACGTCGTGGTATCAGGATCAGAGCTAACAGCATCAATCAGCTTTCTAGCTGCTAGTACATCGTA
CTCATTCTCTGTTCACGCGGTGAATAATGCTGATCTGGTGGGGCCTGATTCGAGTGTCATTGTATCGACTGGTGATGCAGTTGTACCACAGCAGCCCCCT
CCACCCGAGCTGCTTTCCGCTACGGGTGGAGCACTCTACGTCGCTGTGGTCGCTCCAGTTGACTGCGGTGGTTCGGCTTTGAGTACGTATGTCCTAAACA
TTGCTCGGCATACCGGAGGAGCTTTGGAATATCGCCAGTACGCTTCAGGTCCAATTCAAAATTCCCCATATGATCGGCAACTTGTGAACGTCTCAGTGTA
CGGCCTTCTGTCAAAGTCAGAGTACTTCATTACAGTTTCCTTGGCAAACGCGGTGGTAAGAACGCTTGGTACACTTACTAAACCAGCTTGAAGTATACTA
ATAAACTTGTGTTCTATGGCAGGGATGGAGCCCGCAAAGTGAAGCGACAGCCTATTCAACCAGCGGACCAACTCCTGTTCGTGAAATGAATCCGCCGAAG
GTTGCACTTGAGGACCCTGGTGAAATTACACTGGAATGGGATACTCCATTGGATCCAGGTGGAATTGGTATTGTGGGGTACACGGTGCAATCACGCTACC
AATTGGCAGATGGATCGTGGTCGCCCTCGAAAATTGTGTACGACGATCGATCATCGTTGGCGCGAACAGCTCTGATCACGGGCATACTTCAAAATACCCA
GTATGCCTTCAGCGTCACGGCCTACAACTTCCGTACGTTGTGTCGATCTGATGAATACGTGACGCCAAGTGATGAGCTTCTTGTCCAAAGTCAGGATGCT
TCGATGCCTTCCCAACCGAAAAATTTCCATTACGTTCAGATAACCGGTGGATCGATTACCTTATCGTGGGACCCTCCTCGTTCTCCGGGAATGCAGCCAT
TGCACTCGTATCTGGTGAACGGAAGCATCGAGGGCGCTGAGCTACAATTATTGGCAAACATCAGCGCCACAAGTGCAACTTCCGTTACCTTGTATGGCTT
TACCGCTCTAACGGTGTACGAATTTGCAGTCGCTGGAGACAATGGTTTGGGGGCGGGACCATACACTTCCATCTTACGTGTAACTACCACGGTCATAAGT
GCTCCGGGGAAGCCCAAGAACCTGAACCAAATAGCAGTTTCTTCTGGTGGATCGATCAAATTGACGTGGGACCCTCCAGATGACTCGGGCGGGGCGCAGG
TTCAACAGTACACGGTACTTCGCGATGGTAGCGAAGTCGGAGTGGTGACCACGACAATATTCGTCGACCAAACCGACGTGGCAGCTGAAATGAGCTACAG
CTACTCTGTTTTTGCGTCAAATGATGTTGTGTCCAGCACGGAAGGCGCCGAGCTCGTAGCTCGTAGTTCCAGCGCGTCTGTACCGATGCCTCCTGTTGCC
ACGGCACAAGCCAGCAGTGGATATGTGGTCATGACAATCGTACCATCAACAGACTCGGGTGGTGTTCCGGTAACCCACTTCCTGCTAACGGTGCTGCGGG
GAACTGTGCCTGTCGATACGTACGAGACGTCAAAAACCGTCTTCACCGTGTCGGGACTTTATGCAGAAACCAAATATTCAGTTCGGGTCCAAGCCGTCAA
CAGTGTCGGAGAAAGCGACTCCACCACTGTGGATGTGACAACTGACCTCGCTATTGTTCCTGATGAAATGGTGCCCCCAACTCTGGTGAGCGTCACGGGA
GGTGCCTTGCGATTGACTATTGTACCACCCGCGGATTTTGGCGGCGCCGAAATTCGCGAGTATTACTTTTACGTAAATGACACGGAGACTGACGTGATGG
CGATTTCCGATACCATCTATGATGTGGTGGGCTTATCAGCATTCACGGTGTACTCTATCGCCGTTTCAGCAAAAAATACTATCGGTGAAAGTGCGCTGAG
CGACGCAATACTTCTGTCGACTACCTCGGTAACTAAACCAGGTGAGGTGTGGAATTTAGAGAGCGTTTTTCAGTCGTATGATACGATTGAAGTCGCATGG
CAGATGCCTCGAGATACTGGAGGAGATGAAACAACGGTGACATATGAAGCTGAGCTTAGTTCAGGTACAGATAGTACGAGTACCGTACCTTGTATGACGA
GCTCAGCTACTTTCTCGGACCTCCAACCGGCGACGACATACATAATTCAAGTTCGAGCAAACAACACGGAAGGCGTTGGTCCATGGTCGACCAGTATAAG
TGTGACAACAGATCCGGCATCGCCTGGAATCATTAGCTTTACAATGAATGAAACCACAGTGTCGGAAGCAGGAGGCTCGATAGAACTGTCGTTGCTCCGC
ACAATGGGAGGATTCATGTCTGCCAAGTGCTATTTCACAACAGTTGACGGTACCGCTGTGGCTGGTGTTCAGTACGTGGAAACAAGCGGAGAAGTTGACT
TTAATCGGAGTACCAGTGCCCAAAGCATCGTTGTTTCCATCATCAACAATGCCGTCACGGACGACCCAGACAAGTATTTTTTCGTTTCAATCCAGCCGTT
CGATGATGAATCAGGAGAAATCGGAGATAATTCGACCATCAAAGTTACGATATTGGATGACGGAGATGCTGGAACTCTCGCATTTGGCCAGATCAACAAC
GTATCCGAATCGGTAGCTACGCTTACAGTGAAGATTATACGAACCGGGGCGTTTAGTGGCGGTGGCGATATTGCAATTGATACAGTTGATACCCCTGGGG
GCGCCGTGGCTGGAATCGACTATAACATCCAAAATTCAGTTGTGAGCTTCACTAACCTACAAAAGGAAGCATTTGCCACCATCGAAATTCTGAATGACGC
AATGTATCAAGTACAGAAGACATTTCAGTTGACGCTTCGAGCTATCAGTGGCCGAATCTCGGTCGGCGATCCTCCAGCTAGTGCTTTGGTGGAGATTTTG
GACGACGGTGATGTTTCGCCTCCAGGGATACCTCCCTCCCTTCAAGCTGTGATAATATCGGGTGGAGCAGTAAGTGTCTCCTGGTCAACTCCCGACTATA
TGGGTGCGAAGACGGTCAGTGCGTTATCGTATAGCATAAGCATATTGGAAGTGCAAAGCAAGTTTACTCGAGAGCAAGCCGCGGAAACATCGAGTGCAGT
AATTGTGCAGCTTGCTGCTCGAGCGGCTTATCGTATCTCGGTTGCGGCCAAGAATGGGGAGCTATTGGGTGCGTATACTGATCCTGTGTCAATAACGATG
GGGGCTCCTACGCCCTCATCGCATCCCCTGAATGTTCAAGTGCTCTCTCGAACTGGAGGAATGGTGACATTGTCCTGGACAGCTCCTTTCGACTCTGGAG
GCGATACTATTGGAAGCTATCAAGTAAATGTGACCAGAAGTGACGACAACGTTAATGTCGGGACGTATACTACCAACGATATGATGACATCAGCGAATAA
CCTTGATCCACTCACGAGATATAGTGCGACGGTCGAAGCAATCAGCAAAGACGGACTCGTTGGCAATGCCAGTGACCCCGTGGTGTTTACAACAGTCGAA
GCTTCTATACCAGGAAAACCAACGGATTTGGAGATACCAAAGGCCACGGGAGGCGCATTGTACATGCGAATGAACGACCCACTCGATGTTGGTGGCTCGC
CCATCTTGACGTACACTTTGCTCATGACATCAGCTCAGTATCCAACTATCTTCCGGCAAGTTTATGAAGGCCCAAGTCCATGGTTTAATGCAACCCATTT
GACCGTTTCTACGGCTTACAGACTGCAGTATAAAGTGGCAAACAACGTGGTGCGTCTCTCTCTAATATTACTATTTACTAGTGTGTGACTAATGCCAAGT
TCATTGTGATTCGTGAATGCGCATAGGGTACAAGTGAGTTGAGCGATGTGTTTGTTGCGAGCACCAAGTATTTATCGATTCCGGATGAAGCTCAGAACAT
CGTTGCGCTTTCTCGAACTGGCGGATCCGTCACACTTTCCTGGACACCCCCGTTCGATTTTGGTGGAGCGGATATTACCGCGTATGATGTGTCGTTCTTC
CTTGGTGCTCCGATCAGGTCCCAATTCCGACAGAGGGTGTCAGGCGTTAATCCAAATGCAACATCAGTAACGGCGAAAGTGGTGGGGCTGCTGGCGAATT
CATACTACGGATTTTCAGTAGCTGGCGTGAATGATGTGAGTGTTTGCGAAGACCCCTCCGTTATATTGACTCGCACGATCGTGTATAGCGCTACGGATCC
GTTGGTGTCTATACCAGACAGACCACGCGGCTTAACTGTCGCCCTCAGTACGTCCGGAATGCAGACCATGCAATGGTCGGCCAGTGAGGACACCGGAGGC
AGCTATTTCGTTGCATACATTCTGTATTCGAACCTTGGTGAAATCTTATACAATGGTACAAGTACGTCTTTCGCCCGTGGATCGCTGACCAAAAACACGA
AATATGGTTACGCTGTCTCGGCCTGGAACACGGCAGGAACTAGTAACAAGAGTGATCTCGTGTTTGCTACCACTACTGCGGTGATTGTTGCCCCAAGCCA
ACCCCTTGAGTTCACCAAGACAAATAGCAGCGGGGGTTCAATTGGACTCAGTTGGCAAAAGCCCCTGGACAGTGGAGGAGACAACATAACAGGGTACACA
CTCTATCGAAACGCACTTTGGAGAGCGGATGTCGGTGCTAGTGGATCTGTCCTGTCATTCCTAGATGACCAAGGCCTCGTGGCGGATCATCAATACGTCT
ATGTTGTTCACGCAAACAATTCGATTGGATTGGGAGCCATGAGTGACAAACTAACTGCGAGTACGTCAGCTGCAACCGCTCCAAGTCCACTAACAAGTGT
TACTGCAACAACTTTGGGCGGAAAGCTCACAGCAACTTGGGCCCCAGCTCCAAATACTGGCGGCGTTCCCTTGACATTATTTCATCTCCAGGTGCTAATT
GATTCGGTCGTCGCTTTTGAGACTACGACGGCGAACACGCTACTGTCGTACTCTGTATTTGGAGTCAGAGCAGGCACAACCTACACCGTTCGTGTTACTT
CGGAGAACCAGATTAATGAAAGTTTACCCATGACTCAAACGCTGACAAGTGGAGTCGCACTTCCTCCCGCAGCACCACCAGCCCTCGAACAGTACCTCGA
TACGGCAGCGTTGCTACCTTGGATGATACGTTTGAAGTTACACCTACCAATTGATGACGGCGGAGCCTCCATTTCTCAGTTACTCGTGTATCAAAACGGC
ACAAAGGTTGCTTCGATTTCGATTGATGCCGCGGATCAAGCGGTTCTGGGGAAACCAACGACGCGGTTTACACTAATTGATGTAGGTCCTTTGCACGCTG
GGTCCGTCTACTATTTTGCAGTCTCGGCTGTCTCATCCGTGGTTACAATTGGCGAGGGTGCACGCAGCACTGCAGTACAAGTGGTGACAAATCCGGCAAC
ACTTCCATCTGTACCGCTCAATTTTGCGGTTGGACTTCGAACATCTTTCTCTGTTTTCCTTAAGTGGGATGGCCCGATCGATACTGGAGGCGACGATGTC
TTTTATGAAATATCGTACACCAACACAAATACTTCCGAAAGCCTTGGGATCGTAACTGTTAGCGCCACAACCGTTGAAGTACCCAAATTGATTCCCGGGT
ACATTTATTCGTTTCAAGTGCGTTCTCGAAATTCTGCGGGGCCTAGTGAGTGGGCTGCGGGTCTAGAAACTCAAACCGATGTGACTCAGCGTGGCCTGCT
CACGTACAATATTGCGTCGTCGAGTGTGTACGAAAACGTTTCGAGTGTGACAGTTTATTTGCTTCGTGTGAATGGATCAGCGGGTACGGTTACCTGCAGC
TACACGGATGGATTTGGTACGGCTGTGTATGGTCAGGACTACTCGTTGCCCCCAGAGTCGGAGAGATCGTTTTCGTTTTCTGGAGAACTAATGAAGCAGA
GCTTTAGTGTGACGATCATCAATGACGAGAAGTACGAGCCAATCGCGAGGACTATTATTTTAATTCTCACAGACACTACTGCGGATCGAAGTGAACCGAT
AACTCCAACCACGATCACAATCTCGATTTTGGATGATGGCGATGCGGGAACAATCGGCTTCGCTGTCAATGCAGTTAGCGTCTTAGAAAACGCTCGAGTG
CTATCGCTAAGTCTCCAACGTCTGAATGGCAAGAGCACAGCAACGAGCGTTCGAGTGATCGTGTACAATGGACTGAATAGTACAACGCAACCCGAAGTTG
GATTCCGACTGCCTTCAGGCTCCATTGACTTTATGGATGGTCAAGTCCAGCGCGACGCATCTATTGTGATTAAGGACAACGACGCCTATGACTTTCCCTA
CCTGTATTTCTATCTCTCCTTACAAATAACAGCAGGCGCGGCAACCATTGGCGAGTACAGCGTCATTCGTGTTGAAGTTCGGGATGATGGGGATCGTTCC
GTGCCTGGATCGATGAACGCGCCTACGCTGAAAAAGGCTACAGGTGGAATGCTAGCGCTGACGTGGGATCCTCCAGGCAATGTTGGCGGTGATACTCTCT
GGATTACGGGATACAGCTTATCGATTCGCTCGGGCAACTCCATGAAATCGCTAGTCACACAGACGAACGCGACGACATTGCCTTATGGAGACCTGACTGC
GCTCACCAACTACAGCTTCTCTATTTGTGCGATAAACGTGATCGGACCAGGATCCAGCAGCCCAGATGTTACATTTGCGACGACAAACTTTACAGCTCCA
GGGCCACCAGCTGAAATTGACCTGCTGAATCGTACTGGTGGTTTGATCACAGTTAGTGTTGCTGTACCGATCGATACGGGAGGGGCCCCAATAACAGGAT
ACCTAATTTATGTCTCAGAACTAGACGGGGACTTCGAGGTAGGGAAACGCAAAGGAAGCTCCTAATATTCGGCTGGCCTTCACTAATAACGGTGCTGTGT
TTTGTAGCTGGCGTACAATGGAACTGGACAATCCTCGAACCAGATACCTGTAAGCGTCGGCAAACCAAATACGAGCTATTCATTCCGAGCACAGGTTCGT
TCTACTTTGTGTATTTATACGGCAAATTTGATGAGATGTATTGCTGACAGCACCGATACGATTATATCGATACAGGCAATCAATTTCATGGGACCTGGTG
AGAGATCTGAGGCATTTTATTTTGTTAGCGGACCGCTGTCACGTCCAGGACCTCCACGCCTTCCATCAACATATTCTGCAACAGGAGGAGCAACATCGTT
AGCTCTCCAACCCCCTCTTGACACAGGCAAGTCAGCGGTGACTTAAGTTTCGATGCATGGTATGATGATTGATATTAAATGTAATGTGTCGACAGGTGGA
CACGACGACATGTCGTACATGATTTACTATCGCGAGCATGGGTCGGGCAAAAGATTCACGAAAGCGCACTCTAACGCTGACGGATTGGAGTTAACTGTCT
TTCGATTAGCAGCGAGTACGGTCTACGATATGGTTGGTGTGTCGATGCTTGTGGGTGATGAAAACCCACTCACGTCCGGAGAATTAAATATTGCCGATTC
AAGCATCGTACTTGATGAAAACGTGGCCAGTGATATTGTTAGAAACGGGTTCTTCGAGTATTGTGTAAGCTCTGTTTCTCTATATTTCCGAGATTTTCGA
GCATCAATTTCTAACCGCACGGTTATGATTGCAGGACTTGATTTTCGAGGTTGACACTGCACGGACCCAGGTCAACAACACGATCAACTACGTGGCATCC
TTGAGTGCAGATGACGGCACACCAGCTTCTATGGACCTTGAAAGTGGGGACAGTTGCGACGTATACGTTCGGGGCGCGTTCAGCAAGGTTTCCAACTTCA
CTACGGAATCACCTTCGAAACCCGGAAAACCGCCTCCACCAACTCAGTCTGATTTCAATGATAACACCGGTGGTGCACTTTTCATCCTGATTTCTTGGCC
AGATGATACTGGTACGTTAACTCCTTTATTTTACCCTACAAAACGCAATCTAACACGCCTTCGACACTCATAGGTGGGGTGCCGATTACGGGATACGAGT
TTTACCTTAATAACGAAACGGTAAGTTGCCTGGCGTGCGTGAAGAGAGTATGGTCTAACATCGTCATTGGTCAACAGGTGAATGGGGAATTGATGCGCTA
CGTAAATACGTCAATGTTTGATCTTTCCGTCACAGTGAAGATCGGCGGTTTATCGCCTAACACGTTCTACAGTTTCTACTATATCCTTACAAACGATGCG
TCAGCGTGTGGAAATGGTACTGAAGACGACCCCGAACAGTTCGGTTTTTCAACGGGAGATGCATCTCTACCAGACATGATTCCAGCTATCAGGTCCATCG
GATCGACTGGTAGTGGAATACACGTGACCGTAACGCCTCCTACCGACAGAGGAAATGACCAGCAACTGTACTACCAGGTTTACGTGGGTGAAAGCAAACA
ACCGTGGAAGCTTGGGTATAATGGTACGGATGCATCGTATTGGCAGACAAAGCTCCAGCAAAACAGTGTTTACAGTTTCATGGCGAGCTGTTGGAACGGA
GTTGGCTACTCCGATAATTCGAGCGTATATGCGCTTCGAACAACGGATATATCCCCGCCTGGACCTCCAAGCGGATTAAACTCGACAGATTCAACTGGTG
GTACCATCACGCTTTTCTGGTTGAGCCCCGAAGATGATGGCGGAAGTATGATTACCTCCTACTGGGTGCATGCACAAGATTCCATGGGGAATCCAGAGCT
GGTTGAGCAAACGAATTCGACAGAGATAGTTTTCGGGGGTCTTCTCGCACTCAGAGCGTATAAGTTCAAAGTTTTCGCGGAAAACAGTCTTGGAACAGGT
TCGGACCCCGGAGAGAGTACCTTTTCGACCACTGTGGCCACCTTGCCGTCGTTACCAGGAGATCCCGTTATCAAGGAGATGTCGGGAGGTTCGGTAACAT
TTGCTATCGAGCCCCCACAAGATACAGGAGGTGTTAGTGTTGACAAGCTGGAATGGAAAGTTTACGCAAATGGCGTGAGATTTCCGCCAGACGCCGTCCG
TCGACGAACAAGTCTGAGTTCAGTAGCTACCGGCTCATCTTCTCGTCGATTATCGTCGACGGATGCTGGACCTACCATTTATCTTCAAGCAGGAGGCTTA
CTTCCATCCACGACCTACAAATTCACTGTTCAAGTCGATAATGGGGTCGGAGCCAGTGATATGACGAATGGAGCGGAAGATGCCACTTCAGTAGCAACTG
TACCTGGAGCACCGGACCCACCGACAGCCACTTCAATAACTGGGGGCTCGATGAGATTGTCATGGACCGATCCGATTGACTCAGGTGGAGCTCCACTAAT
TTCATTCCGGGTTAGTGTTCAACAAGCTGGAGTTGAAGTGGGGAAATGCGAAGGGATGATCCTTTCCTGCACCGTTGGAAACCTATTGTCGATCACAGAT
TACATGGTGACTCTAGTTGCTTACAATCCTATCGGCCCGTCTCCATCTAGTGCTGTTGCTATCATCACGACCAAAGTGACGTCTCTCCCTCAGGCACCAC
AAGGCGTTCACATAGCGGAAGTGTCAAGCACGTCTGTCACTATCCACTGGGAGCCGTGTATCGATTTTGGTGGCGGCTACGTGGAAAACTACAAAGTTGA
TATCGTACAAATACTGAACCCCGCTACTGCGTTTTCGGGAACAGTGCCCGTGTTACAGCTGATTTACAGTACAGACGGCTTGACCCCCTCGACGGACTAT
AAAACTACAGTGGTAAGTATTCCAACACGGCCGAAAGTCTTGGATTGAAAATATTGAAGTGGTCTAACTTTCGTTTTATTTTTATTGTTCTTACAGCGGG
CAGTCACTGGAGATGGTCAACTCGGAACTGCTAGCAAGATTATCTTCTTCAGAACACCGAAGTCTGCTAATCAACCTCGACCACCTGCCGTTGGGTGCCG
TAAGTTTTGGTTTCTACATGCACTATAATACACCCCCATACTAATGTTTCTTGCTTCATACGAACAGATTCACGGACTGTTGCGAATGTCTATTGGCAGG
CTGAAGATGATGCAGCTAGTTACCTTCTTTACCGCGACGGCCAACTGCTGCACGACAACGGAGAAGACGTCACGTTCGAAGATAGCATTGTCCTGGGTAA
GACGTACTCTTACCAAGTCCGGGTGCGACTGCTGGATGGAACTTTAAGTGATCTAAGCGAGGTAACGCAATTTTTCGCCTCGACCCCCATCTCAAGCGGA
TTCGATTGCGTCGGCACTGGCGGATACATCCACTGGCACGAATACGGCAACTCTGACCACGAAACCTGGGCAATTATCCCTCAAAACGACGCCGGCATCG
TGATCACTGTAAGTTCGTCTAGTTGATGTGATATCTTGCTGGGAGAAGTCTAACAGCTTTTGTTTTGATTTCCCATATCATTTAGGCCTCTATGTTCTGG
CTCGAATGCAGCCACGACAGCTTGACGATCAACATTACTAGCAATGGAGAGCTGAAGCAGCTGTGGAAAGGTGGTTGTCTTCGTGAGGGAGATTTCGTTA
TTTCAACACCTTCTGGTATCGACAGCGTAATTATTGAGTTCGTGTCGGATGGAAGTATCACGTATGAAGGAATGGCGCTATACTACGAATCCGTTGACGC
ATCTGACGCAGTACAAGATGTGACAGTACCGTGCCCCCTTACGCCAAGCGGCCTGTGCTCGCTAAATGGCGCTTGTCGAAAGGGTGCTTGCTCGTGCTTC
AGTGGATTTGTGGGGGAAAGTTGCAGTAATGCAGTCATATGCCCCAAAGATTTTACAACGTGCACCGTATCGACGTGCGATCCCATTTGCTCTCAATCGA
CTAGTGATGTGATTGTGGTGAGCGTGAATGGAGATGATACTCAAGGAACAGGGAAGCTTATGGATGCTTCTGGGTCTGGAACCGACCCAAAGGCTGTTCA
ATCGCTCAGACGCGCTCTAGAACTCGCAAAACCAAATCAAACGATATTGCTGTATCCAGGCGTCTATCGCGGGAGCGGTAACTGTAGTGTCACGGTATCG
ACCTCTGACATTCTCATCCGTGGGTTGAGAGGGCAAGCAGTGACGATCATTGACTGCCAAAGTTTATGGCGTGGCCTGATGATTAGTGGCGTTTCCGTTC
GACTCGCTGGATTCACGCTGCAGAACACTTTGGCAGCAAGCAACAATAATGGTGCTGCCATTAGCGCTTCAAAGGCCAGTATCCAAATGGAGAATGTCTA
CATTAAAAATGGAAAGTCTCTCCAGAATGGCGGTGGAATTTATGCGTATCAATCTGACCTGAAGTTTACCAGTTCCAAGCTTTCAAATTGCTCTGCTGTC
GCGAAAGGAGGCGCAATATTCATGGATAGTTCGAATCTGTCACTAGTTCAGTCCTTCGTAGAGCTTTCGTCGGCGAGTCAAGGCGGCGGTATCTATGCCC
AAAACAGCGTTACAGTTCAAGGCGATGGAAACAGCACCATTTCGAACAACACTGCTGCGCAAAATGGAGGTGGGATCTGTGCATCGGGAAGTTTTAATGG
AACTATACTGAGCCTGATCCAGAATAATGCGTCGGTTGGAGCCGGGATAGCTGCCATTAGCGGGAGTTCAACCCTTTCGAAGGTGAATATTACCCAAAAT
CGCGCAATTAACGATGGAGGAGGCATCGCGCTGTTAAACACCGCAAATGTGGCTGTTTACTACTCCCCGATACGAATGAATCATGCCGAGCGCTATGGCG
GTGGCGTTTACGTGTTATCGAACGGAACCTTCGACAATAAAGGGGCTTCGGAAATCTTCAAGTGCACTGCAGGTAAGGGGATAGAAGGAGATGCATATAC
GTGCTTTCGAATAAGAGACTGACCAAACGTTTTGTGTAATGTTGTTGTTAAATCAGCTTCAGGTGGGGGATTTTACGGTGGCGAGTGGGCACAGCCAACA
GTGAATGCACTTACTGTGCTTGTGTCGTCCGCTACAACTGCAGGAGGCTGTGCAGCCTTTACTCGCAGTTCAGCAACCCTGAAAGACGCTGTGCTTGATG
TGTGTACGGCTCCTGTGGGCGGAGGACTATTTGCAAGTACCGGGAGTAAAATTTCGGTGCTCCGCGGATTAATAAGATCTGGCACGGGGGCACAGGGGGC
TGGGATGTATATAAATTCGAGTTCGATTGTCGGGTCAGACGATGGACTCAATTCTGTCGTTCAAGGCGGCCGAGCTACTGCTGGTGGAGGGGGTGTTTTC
ATTACTGGAACTCAAAGCTCAATCCATTTTTTCGATGTGCTGAATTGCTCAGCACCGCAAGGAGGTGGCATGTTCGTACAGAACGCAACTTTGGGTTCGA
TGAAATCAATTAGCATATCTGAGAGTAACGCGACCAAAACTGGCGGTGGCCTCTTTGTAAAAGCGGCCACATTTACGGTGATGAATGTTGAGGTGAACAA
CAACAGCGCCGCTATTGGGGGTGGAGTGTACGCTATCGACTCTAGTTTATCGGGTACCATTTCAGTATTTTCTAATAATGGCAGCCAAGGCGGTGGGTTT
GCTTCGTCTGGCACAACTTCGCTGGAAGGAGCAAATATTACTTTAAACACCGCGTGGCAAAGAGGCGGTGGACTCGCAGTTGAGACTGGGGTGCTGGAGC
TAAGAAGCACGACCATAGTATCTTGCTCTGCGGACCATGGTGTCGGTGGAGGTATTTCAATCACGGATGGAAGCGTCAAACATTACGCATTGATCGTTCG
GAATTGTTCATCCACACGAGGTGGTGGGGTTTATGCAAATTCGTCGGAGTTCTACCAGTATCCAAGCGAGGAGAGCAGTGGTATGAGCCAATTCGCAGCA
TCCTTGACTCATAATCACGCCACTGGCTATGGAGGAAGCATTTTTATTGATGGTATGGGAACCCAGGTTAGTGACGTCGTCATTACGGATAGTGATGCGT
CTTTCGGTGGTGGGCTAGCAACCCTTGGTGCTCAAGAATGCATTGTGCTCAACATGGACATCTCAGCATCACATGCGATGTCCGGGGGTGGTTTGTTTTT
CGGGCCTGGTGCAAATTGTGTTTTACGTAGCTCTCAGGTGGCCAGCAACAGCGCCAAAGAGTCTGGAGGAGGATTGACAGTTCAAGATGCCACACTGTAT
CACTCGAACTTGGATATCACAAATAACGTGGCCCTAACTGCAGGTGGAGTAAACGTGCGGAGTGACTCAATGGTATCGAGTCTGTTGTGGTGGGCAGGCC
CTGAAACTGAGCAATCGCGTGTGTATACCAATGTTATCTCTCCGGTGGCTAAAAATGCAGCCAATGTGCTGCTCAACTGCTCCGTCGAGTGTGTTTTATC
TGGAGCACAGATTTTCGGAGGTACCCTCTCAGACGGCCAAGGAGCTGGGGTGTTCGTAGGTGGTGGTGGTAACGCGACGATTTCCGACGCTCTGATCGCG
AATAACTCGGCTGTTCAAGGCGGTGGTATTGCAATCAGCGACACCGAACTTACAACGCTGGAGAATGTTGCTGTTGTAGGGAATTTCGCAAGGGATCGCG
GCGGTGGACTATGGGCTGGGCAGCCCAATTTGCTTAATTTCCCGACGGTGAATGTGACGAGTTGTGTGTTCTACAACAACTCAGCAGCGACTTCTGGCGG
AGGACTCTCGCTGTTTAAGGTGGTGATGGTTAGTTCCATCCTGCTGGTCGTGGAAAACCATGTCAACAACAGCGACATCGGAAGTGGTGGTGGATTGTAC
GCTGATACAGAGTCAGATATCACAGCTGACACGTGGTTGTTTTTGTCAAATGATGCAACAATTGGTGGTGCAATTGCTGGCGTAGCAGCATCTAAGATCA
GCCTCCTCGACTCACATTTTACTCGCGACGTCACTGTATTTTCCACTGAGAGGTGGCAAGATCTCTTTTTCGATCTTGTGGGGTTCACATATGCGGAAGG
ATTAGCCAAGTACAATGTAGAAGTCCAGAGAGGCGGCCTCATCTATTTGTCCGACGAACACTCAGTGTTAGAACTGCTGTCAGCTTCTGTGACCTATGGA
TCGGCCGACGCTGGGGGAGGAGTTTATGTCACGGATAGCGCATTTTTGTATGGCGACAACACTGAGATTGGTCATAACAGTGCTACTGAGAGAGGAGGCG
GTTTGTGCGTATCGAACAGTGCACAAGCAAGCTTCGATTATGTTAAAATCATCTTCAGCGGTAAGAGGCAGTTCCGTATAAAATACTTTGTCCTCATGTT
ACTAACAACGCTTTTGATTGCTGGAATGTAGAGTGCAGTACTTCCGGAGGCGGTGTTTTTGTAGAGACCTCTGGGGTGATTAATGCAAGGAACTCTCATA
TATCGAACAACTTCGCCGATGACTCGGGCGGTGGCATTTATATCGACACCGGGGACCAAAACGTCGTCAACTTGACCGACTCCTATGTTGAGAGTAATTT
GGCGCATGGAGAAGGATGTGGTATGCAGCTCGCATATTCATCAATGAGTACCATATTCTTATTTACTTTAGCTCATATATTGTTTTGTGTATTTCCAATA
GGTGTCTTCGTTGGACGAGAGGCGGGCCTTAATGGATTTGGATCTCATTTTGTGGGGAATGGCGGTGTGACCTCCAGCGGGAAAAATGAAGGTGGCGGTG
CAATCTCGACGGTTGATGGTTCTGTGAAGCTCACGGATTGCACACTTGCCAGCAACACCGCCCTTGTAGGTGGGGCAATTCATATTGACCGGGGTGGATC
AGCGGAGGTTATCAACTCGTTGTTCGTTAGGAACACCGCGGATGAAATGGGTGGAGCTGTTGCTGCGGAGGTCGAGGGACACTTCCATGTCATACAGAAA
ACTTCATTTCAAAACAACCAGGCACCTCTCGGCGGGGCAATCTCCGCATCCGGAACATCCAGCGTCTCTCTAACATCTGCGGTGTTTATCCACAACCAAG
CAAGTGAAGACGGCGGAGCGCTGTTTATCACAGACAAAGCGTCACTTACGTCAACTTTGGGGAGCTTCAGCAGAAACACTGCGGTTTTGGGCGGGGCCAT
TCACTCTGATGAGCAATCCTTCGTTAATATCTCCGACGACGCTTTTGTCGACAACGCGGCTTCCATGCGCGGAGGTGCTCTGTATTATGAGTCTATTGAC
AACACTACTACAACTGGAATCACTTGCCGATCAAACACTGCACCAAGCGGAGGATGCATGTACTGGATTTCAGAAGCCTCGGATCTCACCCCAATTTATC
CGTGTATCGAGTGCATCATGATATCGAACAAAGTGTACGATATTGCAACGAATACGCGAGATGTTCGGGTGATTTGGTGGCCTGAAAACGTAACAAGCGG
TGTGCCTGTGTTGGAGCCACCCGACGAGGAGTCTATCGAGGTACTGGAAACCCTAAACGAAACGCTCGAGTCTAAAATGTACGTCTGGCCACGGCTTAAG
GCTGTCGACCTCTACGGCCAAGTTGAAGTGCTGGATAATCAAACGGAGTGCAGCGTTGCCGACGGTCTTTGCAGTGAGCAAATCGAGCGTGTAGCGTTTA
CTCCATATAGCCCAGTTCGTGCTGCCATTGGAGTTCTCTCGTACCGGAAAGCTACGTTCACAGCCGCCAACAGAAGCGTAGAAGAAGGCGTGTACAGATC
AAACGTGACGTGTACGCTACCTACGTTGGAGGCACGGGCTTTTGTCCAAACGGTGACGCTTTTGCCATGTCAACCTGGATTCTCGGTCAAGCAAGGGTAA
GTACCAGCTATCTAATAGATAAAGTTCACATGTACTGACACGTCCTGCTCGTATAGAATTTGCGAACGCTGTCCAAGAAATACATACAGGTAACTGTGAT
GGGCTATCCAAGGTATAGGTTCCTTTTCTTCTACTAACGTAGTGGATATTTCGTGCTCTAGCTTGGAGGGTATTGAGTGCTTCGATTGTCCCGCAGGAGC
AAAATGCAACATGACAGTTCGACGGGCTACGGAGACAATGGGAGAGGAACTTGGGACCGTATCTCCTCGTACAGAAGAAGGGTATTATCTGTTTTTAGCC
CCCGCATCGAAACAAACGACCAATTGTTTAAGCCCCAGCCAGTGGAAAAAGGACGACCCGTGCAAGCCCCTTGCTCTGGAAAATCCAGCCGCAAATGTGT
CGGAAGTGATCCACAACTGCTCCAACTTGAACGACTTTGACGTGTATTGGTCAGCAGAGCGACTTTTTTCCTGTCTCTCGGGAAAAACCTTCTACACGTG
TGATGTGAGTCCGACAGCTTGGTACAATTGACGGTGTTGGTGGGCGACGATCTCTAATGCACTATGTGATGATCTGGATTTGTCTCTTAGGTTTCAAGTG
CATGCGAAGCTGACGTCTCACTCCAAACACTCTCATTAGCAGCGGACGTGAATAATGCATCGTGTGCTAGCGGCTATGACCTCGCTATTTGCTCAGTGTG
TGCCAAAGGTTTCAAGCGAGCTCAGGATACGTAAGTGCGCATGCGTAACGTTGAGAGGCGATTGAACTGCTTACTTACAACCTTGCGAATCTATCGTGTT
GCAGCATGCGAACAGGCAAATGCAGAAGTTCGGGCATCCGTTCGATGGCAGAACTTCGTCATCCCAGTGATGCTGGGTATTGCGCTTGTTGCGGGCATCT
ATGGAGTTCGCATTTATCTCCGGGATGTTACGGAAATTGGCTTGCTAGCAAAAGCCGAAGCCGATAGGAGGCTCAAGCCTCCTAATACTAAGAAGGGTGA
AAGTCTTGCCTTACGAGCAAGCATGAAGTACCTAAGAAGCTCGATGGCGGTGGTGGGGAGAATGGATCGAGTCAAAGACAAGATCAGAGAAACTTGGAAG
AAGTATCGCCACCGAAACGCGAAAATTCTGTTCGGCGTCGATGTCAGCCCCCCAGCTCGGACGTTCCCAGTTAGCCCAAGCAAGTTCAAGATTTTCATTG
GGTTCTTTCAAATATTTGGCAACTTCCAAGGCTCTTTCGTGGTGAAATGGTCGTCGAACATACAAGATTTCATGAGTTTCTCACAGAAATTCAATCTGGT
ACGTATGCTTCCTAGTTAATCCACGTGTTCTGTCTGTAGGTCGAAAGCGCCATACTAAAATCTACCCGTGTGACTGCGATCTAGGACTTGGTGGCTATTG
CCGGTATTGATTGCGTGGTCACAAAAACGTTTTACTTCGACTTCACGTAGGTTCTTAGTACAGCTTCCCTACTGTTATGCTGTCTAATACCTTTCCTGCA
TTTCCTGCCTAACAGAGTGACCGTGATCATGGTTGTGATTGCACTTACCGTGATTACTACTTACTTCTACGCTGGAATGCGAAGCTACCGATCGAAGCTG
CAGTTAATCCCGCGAAATTGCTTACGTTGCGGACTTCCAGTTCTCGAGGGCGAGACCATTCAGAACGACGATGAAAGCTTGAACCCTCTCCGGTTGCTTC
GAAGCAGGTGGCGCATCCACAACTTTTACAAGCACGATTCATCGGCTACTGCACAGAGGGAGACGAAGGGGGTTTCGGAGAACGAAAGCTCCGTTGCTCT
ATCGACCCTCAAGGAATTTCGTGCACTGAACCGTAAGTTCGGAATGTCCCAGGTTCGCACTCCGTACCTGCGTTTGTTCCGCTCAGAGCATTCAAACTGT
CCCGTGAAGCGTCACGTGCTTTCCGGCGTCATGCGTGAACGCACCATTCGCAGTAATCTTCGAGTCTGGCAAGCTCGCGTGAAACTACGCATGAACTACC
TTACGTACCGCAACAAATGCCTCAAACTCTACTGCTGGATGGCACTCTTCCTGTACCCCTCCGTGTCGAAGACGATATTGGCAGTGTACAACTGCCAGGA
AGTTGGTGATACGTATTATCTCGTGGCTGATCGTCGTCTGGTGTGCTACAACGGGGAGTGGGCATTGTTTGGTATAATCGCAACCATCGGTGTCGTTGTA
TGGGTTGTGGGTATCCCGTTCTTCTTCGGTCTACTCATCTGGCTAGCTCAAGACCGCGGCGTTGCGGCACGCCTAAGACTCCTGCGTAAACCGCAAATGC
GCGTCCAAAGACAGAAGTGGCTCAAGGAGGTTGAAGACCAGCAAATAGCAGATGGCCGATATGTTCGAGATATGGATAATGTCGAGGTCCAAGATGAGGA
GCTGGCGAAGTATATGAAGCGCAAGAACTTGACGGTACCCGAGCACTAAGCATGTATGGGTAGCGTCGATAAAGACTGACATCGTGATTTGTATTGCATC
ATAGGATTCCACTGTACAAGCGCGACTAGGATTCATCTACGCTGAATGTAAGTCGTAACCGCGCTACTTTGACATCATTTTCTGCTGGCTCAACCCCACT
TTTTCTTTTGCTTACAGATTCGAGCGATTATTGGTGGTTTGAAGTCGTTGATCTGTCACGAAAATTGTTTCTTAGTGGTGTGATCGTTTTCGTCAAGAAT
GGGAGTGTGGAACAAGTCCTCCTTGCCCTCGCTGTCTGGTGGGTCTATGCTGTGGGTAATAGCATTTGGTAGGGCCAATACTAACATTCCGGTTGTCTGC
GACTGGTTCAACATTCAACAGCCTCGTGACGATGTGGTTCCTGCTATATTTCCAGCCGTACGAAGGCTATTCCGATAACCTGATCGCAAGTATCACTCAG
CTCCAGCTCTTTTTCACGCTGTGGCTTGGAGTCATGATCACGCTCAACAACCTCAACACCGAGTCACTCATCGACGTGAACCTGTTGAGTATCGTACTCG
TGGGGACATGTATTGCCGTCACTGCGTTTGGTCTGAGCATGATCGTTGGGGAAGGTCTCACCGAGTCACGACGAATTTATACTGAGGCCGTGGCTCAGCG
CAAGAAACAATTGCAAGAAGAAATCCGCAAACGCTGGTTCAAGGCCTTCAATTATGCAGCGTACGAGACGCAGATGCTTCGCTACGGCGGCCGGTTCAAT
TTTACCGATTTCAGCGTGCCTGCACTGCTGGAAGCCTTTCGTCGTGCGAAACTCATAGAAGAAGGGGACCCTGAATTTGCCAGCGTCATGCCCAAAATTG
AAGAAGCTGAAGCGCCGTCGTTAAATCTGCGGCAACCAGAAGCGAATACGCAAGTTGATGAGCACGGTGAAGGCAGCAATGACGTAGTGCTTGGCGAGGC
TGAGGAGATACACGAAGAAGCTGCGCAAGGAACGTTGCGGTTTAGAGGTCAGCGGCAAGTCTAAACACACACAGCAATGCGCCAGGGCATAGGCCACGTA
GAAATCTGTATACATACTTGTAATACCTGTATATATGCGCATGTTTATCTTGTCTACAACGCCTATGGCGGAAGCCATTCACCGTTGTGAGAACATTCAC
CGCCGCGAGTTCGGCTGATTAGACGATGGCCCGCCGCCCATGCCGTAATTGCAGATCTGGCATTCCTGAGTTCTCCAGTGATACGCCCCGTTAATGACAT
CAAAACCGACAGCGAACTCGGCGCAGTATCGGTCGTACAGTGCCTCCCACTCGCCGAACGTTACGATTTCGTACTGACGCGCGGGGGTTGAGCCCAGCCT
GCAAATACAAACATCAGTACAACAAGCACGAGTCAGCCCAAACACTCCCAAACAGTCAGTAGTCTCCCAGTCAGCCCTTACGCTTGGGTGGCCTTGAGGG
ATTGCTCCAGCGAGAACCCTGACAGGAACAGCGAAATGTATGGCGGCACAATCGTCTTCTGATGCGACAGGCACACCAACTCTGCATTCAGCACTGGCCC
AGGGGCATCGTCCCCTTGGCTGCGCACGAACTTCCTCCACTTGTTCAGCCACTTCTTGGGCACCAGAAAGTACGTGGCATACTTGCTGCGCCCGTTCAGC
GACAGGTGCGGTGCCAACTGCTGCTGTCTGCTTCCCACTGTGTCCACAGGCGAAAAGAGTCCCTTAGGATATCCGTTCTTCCTCTGCAGCAGCTCCAGCA
TCTCTTCGGAGCCTGCAATCTCGCCGTCGAACCTGGCTCTCTTCCTCTCCTCCGCCTCCAGCTCCCTGGCCTCCTGCTCCAGCACGCACGACGTGCAGTC
GCAGCAGGACCGGAGCGTGAATCCTCTCAGCTCTGGCGCGTAGACTGCAATCTCCCTGAACACGTCGCCGCTGACGATAGCGCGACGGCTTCGGCCTACG
CACTGCGCCGCTGGCAGCAGCGCGTCGTGCGCGCACACGATCATGGCTCCCGCTTCCTGAAGCGACGAATTAGCTACAAGCTTGAGCTTCTCTGCGCCCA
CGACATCCTTCTTTTTAGCTGCGTTTTGACGCCGCTGTTGCCGCTTGGTCCGGCGGAACTGCAGCAGGAACTGCTCGAAGGCCTGGCAGCGCTTCTTGTA
GGCGCCGAGCCACGCGCGACTGACGACGACGCTGCTGGGCGCGCAGAGCGCGGCGTCCTCGAAGGAGCGAGCGGCTGAACGAGCTAGTAGCTCCTTGATG
CGCAGCATCTCGGCGCCACGTAGCACGGTGAGCGACCGCGGCCAGTGGTCGGATGCGGCTGGCAGGAACGCCGTGACATCGCCGAACTCGCGCGTAATGA
CGCGCTCCAGGGCTTGCTGCACGCACACGGAGGAGGCGCTCAGGGCACGACATGTGGAGGTAAGCTGGAGCACGTCCCTGGCCGACAGTAGAGCGAAGAG
GTGCGCCAACAGGCCTTCGGGCAGGTGCTCCATT