Description :
From Genome Similarity Track
Location :
Scaffold_45:54234- 55747
Transcript NameFunction/comments
Phyag_g1129hypothetical protein PHYSODRAFT_331251

Sequence
1513 bases(100 bases per row)
CAAAGAGTGCATCGGATTGTTGGCTCAGTATGCTGGTGTCGGATTTCTGGCTGGAATCATCCCGGGGGTGATCTACCCCGTGCTTCAGGGATATCTGAAT
GCTGAAGGCACTATCGTCGTGTCTGCGACCGTGTTGGTGCAAATTCCGTGGTGTTACAAGATGTTCTTTGGCGTGATCAGCGACTGCTTCCCGATCATGG
GctaccgtcgtcgtccgtacATGGTCCTCGGCTGGGTCTTCTGTGTCGTGATTCTATTCATTATGGCAGCGATGTCTGTCCCTGACCCGTACTACGGCGA
TGCATCGATGCATGATATCGACGAAGAAAACTGGACAGCAGAACAAATTGCCAGCATCAACGAAAGCGCGTCCAGCTCTGCTGGCAAGTATGTGGTGCCG
ATGATGCTGGCGTCGTTCGGTTACCTGCTCTGTGAGGTGGCGGCCGATGCTATGGTGGTCGAGTACGCACAGCGTGAACCTCTTGAACAACGTGGGCGTG
TACAAACGGCGGTTTACGCTGTCAAGGCCTCATTTACCGCTATAGGCGCCGCTGTCATCGCGTTCTTTATGAACGGAGAGGAGTATGCTGGAAGCTTTGA
CTTCTCGCTCACATTCCAACAGCTCATGCTCATCTCGGGCATCATCTGCGCTCCTTTGGTTTTCGTTTCGTGGTTCTTCTTGCACGAAGATCGCGTGGCG
GATAAGCCGACGTTCCGCCAGTACATGTCGTCGTTCTGGGGGATGTTGCAACAGCGTGCCATCTACCAGATCGTGGCTTACAAGTTCTTCTCGGGCGttt
tcaacagcttcaataTCGTATCGTCAAGCAACATCAAGCTCTACTGGGTGCACGCCACTCCATTCAACAACAGCGTGATGACCATTGTCGGTACGATTTT
CTACGCTACAACTCTTGCACTCACGGGGAAATACGGCCTCGACTGGAACTGGCGCAcgatcatcatcatcacaATGTGCGGCGCTCTGTCGATCGATGCT
TTCATGACGATGCTCACGGTCTGGGACGTTGTACGCAaccagtggttctggctcgGTGTTCCTGTCATTGAGTATCTCCCTGATGGTATCCGATTCATGA
TTGCTACGTACGTTGTCGTGGAGCTAGCCGAACCCGGTCACGAAGGCGCTCTTTACGGTCTGCTGACTGCTACGACGAATTTGACGACTCCTTTCGGACG
TTCAATGGCGAAGCTCGTGAACGCTCAATTCCATGTGTGGCTGAAGGACATCCAAGCGGACACGTACGTAGTCCGACGTGACGTGACGATTACCATTTGG
ATTTGCTACGGCATGAAGTTGCTTTCGTTGGcgttcctgccgctgcttccTCGTCAGAAGGCTGAAACTCAGGAGTTGAAGCGCACAGGTGGTTCTAGCC
GTATTATGGGTATCGTCATGGTTGGTTATTTGTCTTTTGCCATTGTTTGGGCAACATTGGTGAACTTGTTGTCCATGTACGAGACCACAATGTGCTGGAA
GATCACGGGCGGC