Description :
From Genome Similarity Track
Location :
Scaffold_39:542311- 546281
Transcript NameFunction/comments
Physo_135654hypothetical protein

Sequence
3970 bases(100 bases per row)
GTGCAATTGTGGCTGTGCAGCTGCAATTCTGTCGGCTTTATCCACAAGCACCTAGACACACGGCAATTATGCATAAGAAGTTGGATGTGCTGGGGATCAT
GGACGGTGGTGTACTGGGCCAATGCATGGCTGCTGACAGGCTCTCCCAAGTCGATATATTTGTATATATGAGGAGGTGGATTTATGCATAATTCTAGCAG
GTCGTGTATCTTTTTTCACACATATTTAGGCGCAGGCTTTGCCATATTTAGCGTCTAAAATGGTGGGCAAAATCATTGCAAAGCACAATAATACTAATCG
TTTATTATTGACCAAAACCTGCATTCAAACACTTACGGACGCTCTAGTACACTATGAGAGCGTCATGGCTTCGCTGAATGCGTATCAATTTGCGCCATAA
TCGACCAAGGTTAGCTGAAGATGAACGACATGACTTGTCTAGCTGCAGGCTGCATTTTTTTACATGTCAATTTGCTCAATACCCAATCACTCTTAGCCGA
AGATGCCCAACCTCGTGTCTGTCGCCAAACCAATCAGCTCAACTCGACAGTGACACGAGCATCGTTCGTTTGAATAAGACTTTTTTCCCTCCGTTGAAGC
ACACACTTCCAAGGAACTGGCCCATTAGCGTATATCTCATTCCGCAATTTATCTCCCAAGCCCTCAAGTTAAAAGTTTGTTTGTTTGTTTTGTTTTTGAA
TTGAGGATCGTTATTGTCACTTAGCTAACATCCTCAAGTTAAATGGTCAAGATCAGCGCACCATGCGTCTCTCCTTCGTTCCGCAACTGTAGCTCTCTCG
TCTGGTCGTTAGCACACAACATAGTACGAAAATGATCACAGTATACCTTACCTGCAAAATGAATGAAATAGCTCTCTCGTTGCTGGCGCCAACGCAGCCA
TTGGACGCTGACCAGGGTGTTATGTCACCGATGGCCTCATCAGACCAGGCAACATCAAGTATAAAGAAGAGCGGGGCTTGCCTCACAAAGGTTTGGCTGA
AACATCATTTCCGTATCGATACACTTCGATGTGCGCAACTATTTGTTCAACTACGCATTCTCGGGCAGATGCTGCGGCTGCGAAGCAGGCGCAGTAGATG
CCCACGTTAGAGTCAACTATATAATAAAGAGTTGGGCTGGTAGTGCCTTTTTTAAGGATTAAAAACAATACAACTTTGGGATTTACTCAATTATTAATCG
TTATCATCGTCCATGAAACTATTCGTCGACCTGTGTACCCTCCCGGAGCAACGCTCCGGGTTGCCTATGTTTTAGTTGCTGTTCAGTCGAGCCTGTAAGC
ATTACTAAGTACCTACCACCCGGGCTTTACCTCGCCAGCAACAGCTATGAAGCTGTCTCATTCGTGCCCCCACATTTTCTCGAAGATAAAATCATAAAAG
CCCGGGTATTCCCGGACTTTGGAGTTGGAAGTGGCCTCTTGGCTCATCCTCTCATTCCGGACCAGATGGAGGAACATCGTGGCTTCAAACGCGCCGTGCA
GCGCGGCATTGTCAATAGCTGCAGCTGAGCAATCCCCGGGGCGATTCGCATGCAGCCACTCCATGACTCGAATGTGGTCGCCGGCGGCAGCTCCAATCAT
AGCGTCCTGCGTACAGCCCTCGCTTCGGTGCCGATGAAGGAACTTCACAACGTCAAGTTTACCGCCTTCTGCGGCCAAATCCATAGCCGCTTCCGTGCAG
CCTTCACTGCGGTTTTCATGGAGCCACTTTATAACGTTCAAATGGCCGCTCTCAGCCGCGAAATCCATTGCGTCGTTTGTGCAGCCCTCGGACCTATTAT
GGTGCAACCACTTGACCACATGGAGATGCCCCATAGCTGCTGCGGCGTCCATCGCTAGTGTAGTGCATCCTACCGTTGTGTGCTCATGTAGCCACTTCAC
AACGTCTAGATGGCCAAACCCGGCCGCCGCAGCCATGGCATTCTTGGTACAACCTTCAGTCCGATGAGCATGTAGCCACTGCACCATCTCGATGTGGCCA
CTCTTCGCCGCGCAATCCATCGCACCGGACGTGCAGCCCTCAGTTCGATTCTCGTGGAGCCACTTGACGACTTCCAGGTGATTGTTTTCTGCCGCTGCAT
CAATCGCCTCCGTGGTGCATTCAATGCCATGGCGCCTAGGTGCCGTCCCGAACATCATCTCTGTCATGTCTCCGCTGTACTTTTCTTTCTCTCCCTAGCG
AACTCGATCTCCAGCGAAGGTGCAACTTGGTGCAAGTACTTCACGACGGCTAAGTGTCCATTAGCGGCGGCTTCGTCCATCGCATGTATCGCTCTACCAT
CTTTAAGGGACGGTCGGAAGAGATCGATATAATAGTTGCAGCTAAACTCGAAGCAAAGCCACTGCACCACCTCCAGAAGCCCTTTCCTGGCGGCAGTTAG
CATCGTTTGGCGCGAAATCGGCTTCGCTTGGTGGTCTTTGCCCAGTTCTTTCGCGATCTCGGCCTTGGTGTGGCTCAGATGTTCGGATTCCAGCTTTTCC
TCCTCGTAATCCATTGGCCAGTCCACACGCGCGTTGATGTACTTGGCAACTTCGAGATGGCCGTTGATCGCTGCTGCATGGATGGCCAGACTCGCCTCCC
CTCCGACTGAAGTCACGTACGGAGGGCGCGAGGGTTTGTTCCTTCTACCGAAATACATTCCGCTGTAAGAATCCTCTTCATCGCTATCTTCCTCGTCCTC
CTCTTTATCCCAATCGCACTCAATGACCCAGCGTACCACATCCAGGTGTCCGTTCTCCGCGGCCTTGACCAAGACTCCAGCAGGAATGCGGTCGAACGCG
GACCCGCAGCGCAGAAATCGCAGCATCCTCAGATGTCCGTTGGCCGCTGCTCCCGGTACTCCGCAGATTGGAATGCGAATACTCTGGAGGAGCCATCGGA
CCAATTCCTCGCCCCCATTCGCCACTGCAGCCTTCATCATGGCCGTATCATCTCTCTCGAAGTCCGTATCGAATTGATACAGCCACCTCAGCCGCCTGCC
GCCGCGTTCGCCGTGTCCTTGCCCCCGAAGAAAATGTCTCGCTTGGTGAGACGAGTGTCCACCTCGCTGTCTCGCTCGTTATCGGCGAAATACTGTAGAA
TGTCCATCGCGCCGGCTGCTGCGGCCTCCTCCACCACCTGCATACAAACGCCGCGCTCCGGGAAGTGCTCGAAGATCCACTCCACCATGGACAGGTCGAT
ATTCTTACACCCCCCCGTGAGAGACAGCCAGAACTGGCGCTCCATGTAAGACTCCTCCTGCAGCAGCAGGCGGCGGACAGACCAGGAAGAATGGTCCGCC
AGCGTCTCCAGACTGTCCCATATTCGGTTCAGTGGAGGCAGCGACCCCAACTTGGACGCCCTCTCGAGGGGCAACTCCACGGAAGTGTCCAGGAAGACTG
ACACGGCGTCCACCACGTGCGGCAGAGAGTCGAAACCAAGCTTGGGAAGAGCGGGGCCACTGGGAAAACAATATGGGTACTGTGTACCCATAGTCAGAAA
AGGTAACATGTCCAAGGGGTCTGGTGTATCCATAATCAGAAAAAGGATAAAGTATGTCCGGACCGACCGTCTACATATATTGTGCGTAGCACAGCCGAGC
ATGTAAATTCAGGTGTCGATCGGGGGTGCCCATAGCCCCTACTTTGCGTTTAACGTTGCTGCTTAAGCTCCTCACTAAGTAGGGATGTACTTCGTAGCAT
TATGACGACCCTGCACCAAGTTTTCAAGAAAACGATTCTAATGTCGCCAATCAGACGAGGAAGTGCACACTTGTTCGATCTGAGACGCTACAGTACTGTG
TAGAGCAGCATCGTGTCGTCGCGAGACAAATGAATTTGTGTAAACGCATCTGGCAAGGTAATCTCCATTCGTGAATGCATCGCGCCATGGCCAGAACGGA
ATGTAATCCTTACTTTCTTTACGTGCCCCCGCGTCCTTACAACATGGACTCTTATTGTACTTAGTATCGG