Description :
From Genome Similarity Track
Location :
Scaffold_38:54220- 55884
Sequence
1664 bases(100 bases per row)
TTGAAAAGTGTGTAACACTAGTAGTTCAACTTGGTACGCAGCGGACAGTTGCCGAAATTCAACAAACGCGGGACTTTCACCGCCCATGGCAAACCGATCG
ACCGACTCACACATTTTTTGAGAAGCCCAAAGGCTAACTTCTGCCAACGTTTTAATGTCGAAACGGCCTTGATCTTTGAGGACGAAGTTTCTGTTGCGAA
GCTGGTCTGTGTCGGGTAGGATATCAAGCAGGTCTGGTTGGTGGACGTATCGCTCGTTAAGAATTACTAAGGCGCGTTCTTAAGTTCCCGGGAGCTGGGG
ACGAACCCCTCGTCCGTCAAACTTGATAATTGTAAGCATTTTTTAAGCCCCTAACTCTCGGGAACTACCGCGAATTACGGTGAAAGAAGAACATGGTCAG
ATAGCCCTTTCGAAACGTGACAAAGTGGTGCACACTTGGCGCGCATTAGTGCAGAAATGAAGTAGCTAGGGCGAAAGTCCCACGTCCCGACCGGGACAAA
ACGAGCTCGGAAATAAACCTAGCCCGCTTTCTGAAAGCCAATCAAATCGCTTTATTTCGTCCCGGGACTTGGGACCGGGAACTTCAGAACGGCTTAAGCA
CTGCGCCGGTGCCGCACCAAGTAGAAGGTTGTCGCATTCCACTTCGAACCTTTTGTCAATTCCAGTCCGAGGGTTTTCTGCAGTGGCTATTTTGTGAGAT
CCGCCCACCACCACCTCAAATACTCGGGGTCCGGTCTTCGGAGCCAGAATCCGAGCCTTGCGACCACATCGGTCATGAGAGCTGCAATTGAACTGCGTGA
TAGTCTTGGTGACAGTCTTGTAATTATGCTTCTGCTTAAATCGAGCTCGCTCCGCTGAATCCTTGCCTCCTTGCGCGACGAGAATACACCCAAACTATGA
GCTGTCTTCCAGACGATTGGCGCTGTATCGAACGATGCAGCCATAGCTGGAATAATAGCCGTATTGGACGATGGAGCCATAGCTGTACTGGATGATGTAG
CCATAGCTGTATTGGACTCCTGACGATGCACGTCCCCATCGTCACTGGTTGACCCCCTGTCGGCCCAGCGTGGCGACGACACAACGTTGAAGTCGTAAGA
CGAGTCACTATCAGCCACGAACTCGTCATCACTGTCGGCCGACGCCATGAGTTGACCTGGTCGCTGGACTACAACAGAAGCGCCGATACTGGCTGTGAGC
CCAACGGAGTCGCGAAGTTCAAGACCAGCAAGAAGAGAAAGTGGGCTAAAAGTAACCATCGATGCGAAAGGCTCCATTTAAAGATATCATGAGCCTTTTA
AAGCTGAAACTATGACCTAGAATACAGCATCTCCCAGCCCCCACGCGGAAAACCTGCTCACGAGAAACCTTCGATCCACGCGCGAAAACGCGGAAAACCT
AGGCTAAAACTCCACACGCGGAAAACAGCAAAATCACGCGGAAAAAAGCCGTACCCGCTGCCTTCGCTGCTGCTGCTAGTTTCCTTGCAATCTCGGCCGA
CGCCGCCTTTGCGGCATGTGCTACTGCCCCTAGCAGCCCTGGTGATCGTCGCCCCAACAAGTCGCAGCTGAAGGTGGCTACGTTCAACGCCGAGTTCCTG
TTCCTCGGAACTGAGACCCACACGCTCGTATGTCCCGGAGAGGATTGCAGCTGGACCACGGCCG