Description :
From Genome Similarity Track
Location :
Scaffold_68:54210- 60703
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.18Folate-Biopterin Transporter (FBT) family
Pytir_DAOMBR486fgenesh-pir_contig_68-abinit-gene-0.119CDS Pa_4_9260

Sequence
6493 bases(100 bases per row)
TTGCGTTTAACGTTACTTTTCTTGCGTTTTGTTTCACACATGCACAGCGCCATGGCCTTCTTCTTCGTGGCTCAGAGGCAGCAGCGGGAGCTTCTCAGTC
CCGACGCCAAACTCCCCACTGTCCGCATCATCAAGTTCATCTCCTGCTGTGTTGACTTTGTCAGGAAGCACACAGAGGAAGACGAGTACGAAGAGCTGGC
CGCACGCCGAGAGCACTACAAGCACCCAGAGGTTCTCCCAGTTCACGACCTGGGTCACCGGGTCCACGACGATCCCAAGCAGCGTCACGACCGCGGACGT
CACGATTCCGGAGACGACGCCGCCAAAGTCCATGAACGACAGGTATAACGCGTAGGTGAGGCCGTGCACCTGCTTGTTCGCTGGGCAGTAGAACGTCGCC
ACCACGAGCAGCTGCAGCAACGCAAACTCAGACGTGAATGCCGTGACGAACGACTCGGCCGCACTGAATGTGCAGATCGACACGGGCAGGTGCGCTGAAG
CGAGCAGCGGCGGCGCCAATAGCAGGCGCGGAAGCCCCGCGATCACGGAGCAGATTGTCGACGCGAAGAAGACTTGGCGCACGTTGCGGCCACTGCACCA
ATTGGCGTACATGATGCACGAGAGGAAGCGGCCGACCATGCCAGCAAGTGACATATACTGCAGACACTCAAGCTGGTCTTCGAGCAGCGATAAGGTGTAC
TGGTACCAGACTGAGCCGTCGCTGGGCAGTGCACTACAAAGGAAGAAGAAGAGCATCGTCGGTAACACTGGTAGTAGCACGTCGAACTTGCGCACCACGT
CGTCCTTGAACGAGACCCACGACTCGCGCAAGCTCGCACAGAATGACGGACCGCCCATAGGATGATGATGGTCATACTGGTCGCGATCGTGCATCGTGAG
CTGCGGGGCCGATACGTTGCGACTCTCGTTGATGCCGAGCATGCACACGACTGCGGCGACGAGCGGCATGGTACTCGTCCAGCAGATCACGGTGGTCGGC
GAGATGCGCTTGTCCTTGTACACGGGGATGCCGAGTAGCAGTGCAGCAATAGACGCCACGTTCTTCGTGCCGTTCGCGAGCGACTGCACCTTGCCGCTCG
TGACGCTCGTCTTGTCCTCCGAGGCGATGTCGACGAGGAAGATGCCGAGCATGAGCTGCGCGAACCCCTCGAAGACCGAGTCGAGGATTTTGACGACGAA
CGCGCCGGCGATCGAGTCCACGAACGCACCCGTGCAGAAGAGCGAGAGAGCGGCGCCGACCTCGCAGAGCACGATGTACGACTTGCGGTGGTAGCCGGCG
ATGGGGAAGTTGTCCGAAATGAGTCCGTAGAGCGGCTTGATGTTCCAGGGGAAGAACGAGACCGAGTAGTAGACGCTGGTGGTCGCTGGTGGCATCTTGA
TGATCTGGAAGAGCCACTTGAGGTACGCCGTCATGGGGAACGTCAGGAAGAACGCGTGCAGGAAGTAGAGCGTCAGTAGCCCCACGGGCACGCCCGAGAG
CAGGCCGGAGAGCGAGCCGTGAGCAGTACCATTGGCACCATTGGCTCCATTGCCCATGTTCAAATCCTGCAGCTCTGCAGCTTGTCAATACTGAGTTGCT
TGCTGTTGAGCCCAGTTTGATCACGATGATGAAATAATCTGCCATCCACAGTGCTAGGTGAAAGAGCTTTATATCAGACATAATAATTGTGTTGCTCTGA
AGGCGTCCATAACTGTACTGACATCAAACCATAACAGAACCAATTCATTGGTTCGGAGCCACGCCGGGTGCTGATTGGCTGAAAATACTGAAACGGCATG
AAATGAAGCTCTGGAATGCCAAGGTGTATCGCTTGACACCACCAACCGAAAGTGAACGATCGATCGAGTATTGAGCTCCAGCTGCGCGTGTGTGTGCGCT
GCTGCTACTGTTTTCTACAACTGGCCGAGTGCGTTCACCTGATAGAAAGACACCATCATGGCGAACAAGAACTTCAACGTGGACGACGCCGAGGATTTTG
ACGACGGCACCAAGGCCGTCACGTACGACGAGGAGCTGCACTCGTCGGATGACTCGGAGAACGAGAATGCGCGCCTCTCATCGTCGCGCAAGCAGCGCAT
CCAGACCAAGAAGATCAAGACGCGCGAGCAGGCGTCGTCGCTGCGCGTGAAGAACTGGGAAGCCGGCGCGCTCGAGAGCGAGGAGTACGCGGGAAAAGTC
GTGAAGCGAAAGGACATTGCCTCGGAAGACGAGGAGGATGGCATGAACTCGCCAGATGAAGAGGAGATGGAGGAATGGTCCGAGGCGGAGCCGTTTGGCG
AGTCGGAAAGCGAAGACGATGGTGGTGCGAATGACGAAGATGAAGAAGACGACGAGAGTGAAGATGATGATGACAATGAAAATGACAATGACGACAAAGA
TGCCGAGAAGCTTATCCGTGGCTTTGAGAAGGAGGATTCGGCGCAGCTCATGAGCTCCAAGGACAGTGCCAAGCTCGTGGAGAAAGCGCTTCACGTGCGC
CACCAGAAGATTCTGTGGGAGCGCTGCCTGGAAGTGCAGATCTACACGAAACGATTGCTCTTGACCACGAAGACCGCAACCACTGCCAGTGCTGAGCAGG
ACGACGAAGACGAAGAACAAAAGGCGCAGAAGAAGGCTGAAGCCATTGGGCAGCTCTACTCGTGCATCGATGCTGTGTCAAACCTCCAAGATAAATTATG
CAACATCCCTGAACTCTCCGCTGGGTCCTCGGGCTCGGACCCCAGCAAGAAGCGCAAGCGCACGGCTGACGACCTCTGGAAGGACATGAGCAACGCGAAC
CAGACGATTCTGCCGCAGTACAACGACATCCTCAACACATACACACGCAAGACCAACTTGGCGGGAGGCAGCCAGGCGAAGAAGTTTAAGGCTGTGAACC
AAGACATCCTCGCGCAAGTCGAATCTGTGCTCGCCGACGTGCAGCGCGTGAAGCGAAAAGCGCACGCGCCATTGGACGAAGACAACGACACTACGAGCGC
GGAAGAAAGCTCGGAAGACCTTCTCGACGAACTCATGTACGACGACTCGGACTTCTACCAGCAACTGCTGAAGGAGTTCATCGAGAGCGGCGGAGGCAGC
GGCCAAGACGCGTTGCAGCAACGAACGCATCGCAAGAAGAAGAAAACCGTCAACCGCAAAGCCAGTAAGGGACGCCAGCTCCGATACACGGTGCACCCGA
AACTCGAGAACTTCATGTTCCCAGACCCATACCCAAAGCCGGAGATGGATGCGGACGAGCTTTTCCGCTCGCTGTTCGGCCAAGTGACCCAAGCGTAGAT
TGAAATTTTTTTGGTGCAAGCAGCAACATAGAAGAGAGAGAGAGAGAAAGAGAGTGGAGAACATATTATAGATAACCAATCACCCACCTAATTGACAAAC
CTGCAAACCTTGTTGGGTAGGGCTGTATTGATCATTTTCGCCACTTGTGGTTGATCGACAGTTGAGCTTTCTACAGAACGTCATCCTCTTCCTCTTCTTC
CTGTTGACCCGAGACATAGATCTCTTTCAGCTCGCTGACCTTGCTCTCGACCTGGGCGAGTCGCCTCTCGTTCACTCCATGAGCTCCGAGTTTCTTCACA
ATCCCAACCAGTTGGATAGCTTTCTCGCTCACGTGGATGGCAGAGTGCGCGCGAATTTTCTTCGCGCGAGTGGTCGTCTCGAGCAAGCGGAATTCTTCCT
CGGCAAGGTCCATGGCAGCATCTGCTAGCACGGTCGACGCATCAATCAGCTCAGTTCCTCGGTCATCAAATGACTCAGGAACGTCGTTCTCCTTGAGTCG
CCGGAGCTCCGCAGCGTAAAAGTTGCTCTTGAACACCTTGTGCTTCAGCTTCACCGAGTCCTTCAACAACTGGGTGAACTTGTCAATCAGCTCGGGTTTG
CTCTTCACGCTCGCGCGAAGTGTCACAGGAGCGTTGATGATCTGAGTCCGCTTCGAGATCAGCTGTCCAGCGTCACGATCAAGAAACGAAAGCGACCATA
AGCGATTGTACGCCTTGCCAGCATCCAAGCGCTCTTGCTCCGAAAAGTACCAGTCCCGAGTGTCCTTGTTCTTGATCAGTAATCTGTTAACAAAACCCAG
TTGTTAAAGTTTGCTAAGCGAATGATTGCAAACATTTAATCGAGAAGAAACAAATACCCACCTTGCTGACCAAGTCTGCACAGCGTCTGAGCCCAATGAG
AGGCCAAGCTCCTCAAATCTCGGGCAAATCTCGTTGTAGAACTTGATCGCTTGCTCATCCGTAGCCAGTTTCTTCGCCAAGAGCTCGGCAATTATTCGAT
TCACGTCGTCGCGGTTCTCGACAAGCTTCTTGTTGCTTTCTTTGCGAGCCTTTTTCTCCAGCTGCTCAATCATGCTCATTCCACCGAGTCCCTTTGTCGT
TTGCTGCTCGTCGCCAAAGATGTCATCGATAGCACTGTTTGCATCAGCAAGCTCACGCGCCATTTGGTCCTCGACAGATCTCGGCGGGATGAATCCATGG
TCAGAATTACCGCTCCCGCTAGAGCTTCGTCCACCATTACTGGAGTGGGGAAGACCGCCACTAGACACTGCACAAACCACATAGTTAGATACCATCACAT
CACAGACAAGCGGAAACGCGACGCACATACCATTTTGAATGATCTGCTGGTGTTGCATCAAAATGCTAAACAGTTGCTCCATCGAAACAGGTCCAGTCGA
GCCTTCTGTTGCTGCCACTTGAGGCGGCTAAAACACAACCAAACCAACATCACTCGGTCAAACAATCGGCACGGGTACTTTTCAAAACAGTTTTCCACAT
AATACTCACGCCAGGGTCGTTTGGAGAAACCTCGTCAGGACGATCCAAGACTGTTGGGTCGAGTTTTTCAGCCGACATCTTCAACTTCGCTTGCTCGATC
GGCATTCCCATTTGCAGCAGCTTGAAATACTTCTTGAACGCTGGGTCATCTTTGATCAGAAGAGGCACATATGGCAGTGCCGAAGCGGAAGGTGCTGGAG
GAAGCGTGCTCATAGGAAACACCGGCATACTCATTCTCATCGCACTGGGGTCTGCGTAGTGGACAGGATCAGCTCGTGCAGGCGGCTATCATATATTAAC
AATGCGTCAGTTCATATGAGAAAACCACAATGCAATACAAGGCTGGGCGAGTCACTTACGCCAGGGTCATTAGGGGACACTTTCGCTGGGTGGTCGAGCA
AGTCTGGGTCAATGCCATCTGCTTCCATCTTGAGCTTAATTTGGTCGATGGGCATGTTCATGCCCTTCAGCTTGAAATACTTCTTGAACACTGGATCATT
GCCGACAGTGATCGGAATGTAGGCACCTGGTGCTGGCTAAAGCGCGCATTCGAGTCGGTACGGATACAGCATGTCAGCATGAAAAGAAACCAAATCCATG
AAAATAAAGCAACTGGGAGTAACTTACGCCTGGATCGTTCGGCGACACTTCGTCAGGAGTGTCTAGAAGTGCTGGATTCATTCCATCACCTTCCATCTTT
GCCTTGATCTGCTCTGCTGGCATCGCCATTTCTTTCAGCTTGAAGTATTTGCGGAATTCTGGATCGTCCTTTACCAAAAGCGGTCTGTAGATGCTCTGCG
CACCAGCCACATGGCCACCAGCTGGCATGTTCTGCGTCTTCTTCTCCAACTCCTGGAGCTTCTTCTGTAGCTCTTTAATATCCTTGAGCTTCACAGGCGC
CGAGCTGGATGTCGTGCGATCACGGATCGATTGTTGCGCAGGCAACTTTGATTGCGCCTCCATGAGCTTTTCGATTTGCGCCTGCAGCTTCCCGATCACT
TTCGTGTCCGCCATGTTGTCTGATTTCGACGACAGCTCTAACAATCTCTTGATTTGCGATTCAGTGAGTCCAGGAATTTGGAAGCCGCCCATGTTGTTGT
TCGGCCCGCTCGAGCGTCGGGACCTCTGCGACGACGACCTCGACATTGGTGCGTGTTCGGTATCAGAGTCGCTCTCTTCCTCCTCGGACGATTCTTCCTC
CTCTTCACTCTCCTCTTTCTGCATTCTCGCTATAAAAACACAAGTCGCCGTAGAATTAGCCACGCATTCTGCTTACTATCTAACCGCATGTACCTTACAA
CCTCACTTCAAAGGCGATCGGACAGGACGTACCGGTAATGCAAAATGCTCGATGCGCTTTCGCATTCCGGCGCAAACACATCTACAAAATACACATTCAC
ACATTCACACATTCACACAACAGCACAGCATCACCATATTAGAACAACACATGCACACGAGCCCATCGCGATCTAACAAGCACATAAATCAATTTATTAT
GAATGAACGGCTGGCTTGTCGCACGCACCTCGTTGCAGTAGTGCGCCGAGTGGCAGATGGAGCAAACCGTGGCAGCGTTGGGCTGGCCGCAGTGCACGCA
GTCCTCGCCGCGCGCGCGCATGTTGGTGGCCATGACGGCGCTCGTGAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTATCCGCCATAATCGC