Description :
From Genome Similarity Track
Location :
Scaffold_866:542- 6247
Transcript NameFunction/comments
Phyke_g11185Eukaryotic/viral aspartic protease, active site

Sequence
5705 bases(100 bases per row)
ACGAAGGCTCTGGGCGTGATGCTCGCGGCTAACGCCCCGAGTATCTCCTCCTCCCCTTTCATCGACCGCTGGATTTCCAGCGTCCAGGGTGAGAGTATAG
CGGCCCATTGTGACAGTCTACCTTGCAGCCCTTTGGATCGGAACAGCCACGCTAGTGTCGTGTGACGGGTTAAGACGCGTATCGATCTTCCCGCTAGCAT
CGTGAAACAATTGTTGAGGATGCGCAATAAAGCCAGGATCTCCTTCTCGACGATGCCGTAGTTCAACTCGTTGGGCTTCAGCGTGCGGCTGGTGAATTTC
ACTGGCATGAACACGCCGTCGTGATCTTGCACGAGGGCAGCTGAGATCGCCCAGTCACTGGCATACACGATTACTACGGGCTTCCGTGGCACATCGTAGT
GTTTCAGCATTGGGGTCTTGGCGACTTTGGCTTTCAGAACTTCGAACGCGTTCGACGCGTGCTTCCACTTCTCCTGCTGGCGAACTTCTGGCCTAGCGAC
GTACTCATCGAAGTCCGTCTCCGTGAGCGAGTACAACGTGGTCGCGTAGATCGCGAAGTCGGCGATGAAACGGTGATAGTAATTGAGACTACCCAAGAAG
GACTGCAGACCCTTGAGTGTATGTGGGAATTCTAGATTCATAAGCGGCTCCAAATTATTCGGCTTCGCTTCCAGCCCGTGCTCCGACACCTTGTGGCCTA
GATAGTCAACCTGAGGCATGCCCCACGTGCTCTTCTCCACACTGATGGACAAGTGCCACTGTTCGCAGACGTCTAGCAGGCGTTCCACTTTCTTACACAA
GTCGTCCCACGACGTGCCACCGATCAAGATGTCATCGATGTACGATCGACGGCCCAGAACGGAGTGGAGTCCCGGAAGTTCTGGCCTACCCCCGTCGAAC
ACGTTCTGTGTTTCTCGGTCTGGGGTCAAGCTCCAGAAACCGTAAAGCGCGTTGTCGATCAGTCGTTGATATATCTGCGGCGCGTTGCACAGTCCGAACG
GCATTCGTAGCCATTCAAACAGCCCGAACGGGGTGACGAACGCTGAGATTAGACGAGCCCGATCTGTCATGGGGACTACGCAGAACCCGCTGGCCATGTC
CAGGGAGCAGTACCACAGGTATTTATTCAGATCTTCCAACAAGTCGTCAACCAGCGGCATCGGGTATACCATTAATTGCGTCATCTCGTTCATCCGTCGA
TAGTCGATGCAGAGTCGAATGTCAACTCCGTTCTTCTTTACAATCACGACGATGGGCGACGCCCACGGAGACGTTGATATGCGAATCATGCCTGCACTAA
GAAGTCCTTTTAGCAAGTCGGAGaccttctccttgaactGGGGCGGGATCCTACGGACGCGCTGTGCGATCGGCTTGGTGTCGCCGACGTCGATGTCGCA
GATGACTCCTATAGCAGCGGGCGGCAATGCATTGCCCTTCCCAATCAGCCATTTACGTCGCTTCCAGATGATCTGGCGTAGTCGGTTCTCCTCCTTCGCG
GCCAGCTCCGGTGTGACGCCCGTTGGTCTCCGACTTTGAGATCTTCGATTTTCACTTCTGCAGTCAGAGAGATCTCTGGCAGAACAGCCATTTCCTCCTC
CAACTCTTCCGCGAAGAGGTCCGACCCTTCGTGGAAAAGTACagcgtcatcctcatctGCGATTTTGTCTGGCTCATCTCCCACGGTATCCACTATTGCT
GGTATCTGATTCGGGAGATGTGTTTTTTGCACTTTCTCCAGCGATCCCACGGTGGGGTATTTTTGGAATTCCTCCGGCGACTCTTCGCATTCAGGCACAG
GCGTCGGTTCGGCGGATATCGCAACCGTCGCGACCGACTTCCGTTGATATGTTGCCAGATCTTCTGTCTTTCTTCCGCCTCGACGCATTACTTTCCTGGG
TGTGTGGTATATCAGGCGTTCGGTAGCCGGCCCATCGGGTTCGACGGGCGTTTGATCCTCGTCTGCGTCGCAGGTGGCGCCGTATGAGAGATTCTGCCAC
TCTTGATAGCGTCGTGACCCCACTTGCACAAAGCCGGAGGCGCGTAGAAGGATGTCGACGGGCGCCCACCAGCCCAGCGTCGTGTGGGCGTCGAGTGTCA
TTGGTTTATCGCCAATATTGGTCACCCGCAGGTACGTTCGTCGCCCAATCCTGCTCTTTACGAAGGTGCTCACCCAGGTCTTTCCTCTTGTAACCCATAG
TCGCGGAGCGTTCTGGTCTGGTCGCAGGCGAACGTCGCGCGTTCGCCCTGGGTCGATCCTCTCGGGCGACGCCAAGGTGATGGGATGCGTCTTCGCGCCG
TACAGCGGCCTCCTCCCGATCATCTGGATCCGTACCTCGTCGGGTAGGCACGCCGTGCCGTCCGCGGTGTCGATGCGTACCCCAACTGGCACCATGAAGT
TCATGCCCAAGATCGCGTGCTGGCCAACCAAGCCTCCGACCCAGATGTCCAGGAAGTAAACCAAGTTCCCCGCTAAGGTAACCTTGATCCGTGTTTTCCC
AACCGTATAGTATGTCTCGTCGCGAATTCCCACACAGTTTTGTGTTGTATCCGTGTCAATCAAGCAGCCTGCCTCACGAGCAAAGGTGGCGTCCAGAATG
GACACCTCGGCACCTGTATCGAGCAACAACGTGGCGCGATGGTTGTTCAACTTCCCGTAGATCTTGGCCTGTCGATACCATTTGTCCGGCGCGTAGTACT
TCCAGTATCCGCGTCGTTCACCCGGTTGCAGGTCGATCACGCCTAGCGGCGACTCTCGCGCATACTCGTCGTGGAGTCGGATATCCATGACTCGACGGAC
GCGTTCTTGCGAGGTATGTTTCAGGTCGGGTTCACATGTATTATCGATCGGGGTGGTCAAGCTTGCACTAACCACCTCTGGTGACTTCTTAGCCACATAT
GCATAGACGGAAACAGGTCGCTCGTCTCGTTCTGGTTTCCTAGCCAGCGAGCGATCTAGTTTAACATCTTTTCAGCGGTTGGTGGCAACATTCCGGCGTG
TTTCTGTGGGTCATACCACTGGCGAAGCTGATTGAAGAATTCTTCCATGGGACACCGTCCAGCCTCATGCACGTCCCCACATGCTCGACACGTACGCAAG
CATCGGTCTGTGGGATGACGACCCCCACATTTCTGGCAGGTCATCGTACTCCAGCAGTCTTCGTCGGAGTGACGGTGAGACTTGCGGTGGCGGCAGCGCG
TCCTCTCTCTCCCGGAATCGTCCGTATCACCATTGCGGCGCGTGTTCTCGCCCGGTGGCGCTTGGCCCGTCACAAACAGCTTGGCCCGTTCTTCGTCGTC
CCGATCTTGATCGTACATCtgatcgtcgctgtcatGGTTATCGCGCCCCGAGTCGTATCCTTCCGATGCGACTTGAATCGCGTGGATCGCGCGCGCGGGC
GGCGACGGGGTCGACGTCTTCTGGCGGAACTTGTTCGATCCAAAGagagtcttcttcttgcgtgTGAGTCGACGCTGTCGAGCACGCAGTTTGGTCTTTA
GTGTGGCGACGTCCGGTACTTCCATCAGGGTGAGTCGGGAAACcgattcttcttcttgtgaaCCGAGGGTGCTGATGAACAGCTCCACGTGTTCCCGTTG
CTCCTCCCTGGTGCCATCTGCATAGCGTATCTTGGCTTGCATTCCCGCGACGTTGAGTCGGTACAAGTACTCTAGAGGCGTCTCGTCGGGATGCTTGGTA
GCGTGATAATATCGGCTCGCCATGGACACACCCTTACCGCAGTACTGCAGGCGGAATTGTTCCGTCAGCTCCATCCACGACTTCTTGACACCTCTGTCAA
GCTGCAAATACCATTGACGCGCGGGTCCAGTCATCAAATCACCGAACAGCGCGCATACTTCGTCACCGGTCATGCCGTCGCGGCGCGACGCGGACTTCAC
TCGATTAAGCCACGTCCGGGCCTTCTCATCACTGGAATCTCGACCATAAAACTCTTTCAATTCCGAGAACGCAGAGAGGCGCACACGTGTGACAGCGACT
CCAGCAGTGTCGGTCGTCGTGGCCGAGATCGTCGCCGCGTTTCCGGGCGTCCCGGTCTCCAAGTCGAGCAGATCGTCCGGGTCTTCATCTCGGTGATGTC
GTCGACATGTGGATGGGGACGTGGAGCGTGAACTAACTGACTCCATAGTCACGTCAGCTTCTGCCGTCTTGAGTGCCACCATCGGTTCCTGCCGCACTCG
AGGCGCCTCGATGTTGGCCGTCTGCATCAACGTCGACTGCATCAGTCGGACGATGgcatcctccagcacctggGGGATGACTTCCTCTTTGGCAACTGGC
GGCTCTACACGAGGCGGTGTCGTAGTGAGCTGCATGACCCGGGGTGGTCTTCTTCCTGGCATTGCCATCCGTTTGGGTAGCTCGACGCTACTGTCGAAGT
CCACGCTCGGTGTATACAGGGGAAGTTTTGGCGCTACCAGGGTTGGCTCCCTCCTGACGTGGAGCGGGACGGTTCCCTTCTTGACTGTGGCGACCAGAAC
GGTCAGGGGATCAAGGATGGCCATGATCGCGCACTTCCAGGACGCGAGGTCCCAGTCGTATACTCTCTCCATCTCGAAGGCGCCTAGCACGAATCCCGAT
TCTCggaggatgctgaagagcgcATGCACTGCCAGCCGTACGCTCGTGAGACTGGCGATGTCCGGAGTCACGAAGGGTCCCGTGAACTTGCCGATCAGCT
TTGGCTCGAGGAAACTCAAGATTGGATCGCGTTCCAGCTGCCGAAACAAATCAGTTCGGCATAGAACGTAGTCCAGTTCTTCTGCGGTATACTGCCGCCC
CGAGCCCTTGCTTTTCGGCCTGCGTGGCGATGGCTCGCCCGCCGAGCCTGGCGCGCGCagtttctttttcttcgctGGCTTGGATCCCTTGCGCTTTGCG
GAAGTTTTGGCGGCGGGTGGTTGTTGATCTTCAGTCTTTACAGACATCAGACCGGTAGGACTTCGGCTTGCGTCGAAGTCCGTGGTGGTTCCCTGGGGAA
CCACATCGGGAACAGCGAACTTTTCTTCGAACGCCTCCTGTTCATCGCTGGCCCCATGGCCTGTCGTGAAGGTTCCCTCGGAGCTCCACGACGCGACTGG
TCTCTCTTCGAGCTCACTTGCCGTCGATAACCTTTCAATTGACGGCGCTCccgcttccagttcttgctTGAACGTTACCCCATCTTCCAGAGTAGTACTC
CCGGGTCGCGGCACCATTGTGGAGGAGCGCCCTCGCAAAACTTTGCGAGGTCAGGCCTCACACAAGCCCGTCGCGGTCGGTTCGTTGACTGCGGCGGGTT
TTCCCCGGTACTTGAGTAGCGTATCTCTGGGTAGAGTGTAGTTCTAGCGTTCTTGAACCTTGAAACGTGCCGACGCAGCACGGATTATGCCTCGGTctgc
gtcctcttcttctctgacGTCGCACTCGCTTGTGTAGTGACGTCCCTCTCCTTGTCCTTTGGTTGTGGCGGCGTTATCGGGGCCGGCGCGTCCTAGGTTG
TGCGTGGCGTTATCGGGGCCGGCGCGTCCTAGGTTGTGCGTGGTGTTATCGGGCCGACGTTGTTCTTCGTCTGTAGATCGCGTTATCGGGGCGACTTGAG
ACGGTAACGTTTAACGTGTCCCTCCTGTTGGGCACGGGTTGTTGGGGGGTGAGTCCGGATCAGTCCTGCGGGGGGAGGTCGCGTTATCGGGGCGACTCAA
CTTGG