Description :
From Genome Similarity Track
Location :
Scaffold_1130:542- 6134
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_1130-abinit-gene-0.11AGC family protein kinase
Pytve_DAOMBR484maker-pve_contig_1130-snap-gene-0.6Isomerase
Pytve_DAOMBR484maker-pve_contig_1130-snap-gene-0.7Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_1130-snap-gene-0.8Gene of unknown function

Sequence
5592 bases(100 bases per row)
CACACCATGGAGCTCGCCGGGTATGAGACGCTCGAGCTGCTCGGCTCGGGCCAGTACGGCGACGTGTTCCTTGTGAGGCGCATAACTGACCAGCAGCTGT
TCGCTGCCAAGGTCGGGCGTCGTACCATGGGTGGGCCGAGCGAGGCGCAGTCCGCTGCTGCAGCGCTTCAGGAGGCAGAGCTGCTCGCGTCGCTGCGCCA
CGCCAACATCGTTCAGTGCACCGACGTCGTGCTGCAGGGATCACAGCTCACGATCGTGATGGAGTACGCAGCCGGTGGAGACCTGGACGGTTTTCTGCAG
ATGAGTTCTCAACGGTTAGTGCCTCACAGTGTTGACAATTGCGTTGAGCAAGGGTGTCATCGTGAGTTGTGTTCGTCGCACAGGGGACAGCCGCTCAGCG
AACCAGTAATCATGCGCCTCTTCATTCAAACCGCTATAGCGCTCGCGTATTTGCACGGCCGTCACGTCATTCATAGGTACTCGATGGTGGTTTTGCATGG
TGTGTTGAAGTTGTGCTGACAGGATGTGTGGTTCGGAGCCAGAGATCTCAAACCCAAGGCATGCCGACGCTCTATAACCACCCAAACGAGTCTTCTCAAG
TTTTCGATCTCTGACTGTGGTACTCTTGACCAGAATATCCTCTTGGACGCGAACGGAATCGTGAAGCTCAGCGACTTTGGAGTTGCAAAGGTCCTCCAGA
ACACTCTCGATGCGGCGCAAACGGTGATCGGAACGCCGTACTACATGTACGTAACCGATGTTGCCTAGCTAGCAGAACTTGAACATATATTCGCTTTGAC
TTCGTCCGTACATGCCATGGTCAGGTCGCCAGAGGTGTTGGAAGGACTGCCGTACGACTCCAAGTGCGACGTGTGGAGCTTGGGCTGCATCCTCTACGAG
ATGGCGGCGTTAGTACCTCCGTTCCATGGGAAAGCTTGCGGAGCAATCGTGTACCAGATTCTCCAAAGAGAACCTCCTCCACTACCGCATCGATTTTCAC
CACAGTTCTGCTTGCTAGTGTCGAGTTTACTTGCCAAAGATCCAAGGGTAAGATCATGACAATGACTCCGGACAGCGTCAACTCGCTGACCAAGCGAATT
GAGTTTAGATACGACCCGACATCACATCGGTGCTGCGCCACGGCTTCGTGCAGCAACACATGATGCTGCTTGCCAGCGTGGCGACAACCCAGCAGTCTCT
CGTTGCCGAACAACTCTATGTGCATGGCGGCGAAAGCAATATCCGACCCAACCAACCTTGCATGGACGATATGTTCCAGCCTCCCAAGGTGGCACAACCG
ATGCCAGTTCTACACAACCCCAGATTATTATCTCCGAAGGAGAGTCCGGTCGTGGTTTGCGATCGCACGGATCAAGCGGAGGACATTGCGAGAAGAATCT
ACTTCGAGAACCAGGTTAGAACGATCACTGTTTGTGATGGTGTTCGATAATGACCGACACGTATTGCTGGGTGGACCAAACTAGGCCGCTGCTCGGAAGA
ATAAAGAGCGAGTCGACCAGGAGAGAGCGACGCCTTCTGTGTTCGCGGCCGACCGTGCCGAGCGATTTAGCCAGCGATCGACTGACGACAGTATCAACTA
CGTTGGTGGGAATACTGCTGCTACTTCGCGGATGCACATGGAATTAGGCTGTAAGCAACCGATCATGCGTGTTCCTGATCCGACCGACTCGAGTCGCGTC
TGTCCGATGCCACCGCCACCAGTGCTGCGCCAGAAGAGCGCGCCGTACGTACAGCTTCGAAGTCGAGTCTGCGTCTGTAGCCACGCTAATGTTATGCTGT
GTTTGCCCCACAGCGACGGGTATGAACAGATGCTCGACGCTGAGCGACGCCGCGTTCGCGCCGAAACGAGAGCTCTCCACGAACGCATGAAGGCGATGCG
AGCCAGCGAGCCGCAGGTTCAGTGACAAAAGTGCAACATGCGTATGAGTCATACATGTTGAGTAGTAGTCCGCGAAAGTCTGGATCTCATACTCGACTCG
AAATAGTGACGTTACCGCACACTCATCAGATGTGGGGTTGCCAATTGCGCATCAAGCAAACCGCTGTGAACACGACTGCGCTGCTCAGACAGAGAACGAT
CGAGCAGCATGAGCGGCAAGAAGTGGCTCGACATCGGGTGAGAACCCACTGCGTTCAACGTCTCCTGTCTGTCGGCATGTCTCGCCTCCTCTCACGCATT
GATGCCTGCGCCATCGAGCAGCAAGAAGATCGTCGCGATCGGCAAGAACTATGAGGCTCACGCGCGTGAGATGGGGGCCGCGAGCGCGCCGAAGGACCCG
CTGTTCTTCCTCAAGCCGACCAGCAGGTGGAGTATTGTGTACGTCGCCAGTGGTTTTCGCTTCAGTGGCTCATCGTGCTGCATCTGCGACCTCTAGCTAT
GTCTCGAACGGCGGCAGCGTGCTGATCCCGCCTGGAATCGGCGAGGTGCACCACGAAGTCGAGCTGGGCGTACGTGCGCCAATACCGTTGACCTTAGTTC
TTTGGCCGACCCGTGGTAGCTGAATGTGCTGGCGTTACCAGGTTGTGATCGGCAAGAGCGGACGTGACATCGCTGAGTCCGAGGCCATGGACCACGTCGC
CGGCTACGTAAGTGAGCAATGGTCAAACGAGGAGGCGATTGTCCAGCATCTGAACTGCACTCCACTGTTCTTCAGGTACTCGCGATCGACCTGACGGCCC
GCGACCTACAGGCCAAGGCCAAGAAGGGCGGACTCCCGTGGACGCAGGCCAAGGGCTACGACACGTTCACGGCCGTGAGCGATTTCATCCCGAAGGCTAG
CGTCCCGGACCCGGACAACCTCAACCTGTGGCTCAAGGTTGTTTCGACAATTGTTATTGGTTTAGTGACTGGGGAGATTTACTTTGCTGTTGGTTTGTCG
GTGTAGGTGGACGATGAGCTTCGGCAGAACGGCAACACCAAGGATATGGTGCACAAGATCCCGTTCCTGATTGCGTACGTCAGCCGCATCATGACCCTCG
AAGAAGGCGACCTGATCATCACGGGCACTCCGGAGGGCGTCGGTCCCATCCCGCCCAACAGCGTACGGCCGTGTTCTCTTTCGTGTTGGAGCGAGCACGC
GACTGATCCTTGGATGTGTGTGTTGCATCAGACCATGACGGCTGGCATCACCGACCTCATCGACGTCCGCTTCCCCGTCGAGCCGCGTGTCTACAAGAAC
TGATCAGGCGATGTGCTTCAGTTGTGATAGGCTGGCAGGACGGCAGAGTTCTCCGACATGCCGCTAACTTGCAATGAAACGCTCAATGACCGAGTTGATC
GAGGAATCAAATCGATGCTTGCGCATCGACGACACCCTTCGAACCTTCTTGCGGTGGTCGGAAGCCGGATTCTGGTCCTGACGAGCGCGAACGCACCAGC
CGCGATAGATGGCCTGGATGCGCAGCGCGGCTGCGTCGTGCCGAAGGTTGCGGATCGCCACGATCGCGTTCGCGTGCACGTTTGGCGTGGTCGTGGACGC
CTTGCAGAACTGGATCAGCGTGCCGAGCACTCCGCTTTCGACGAGCTTGCCGCGACTCACGTTCAGCTTGGACATGGCCGCGATCGCGCGTGTCGCCTGA
AACAGAATGTCGTTGTGGCGGTCGCCGCCGGTCGGCGACATGTACTNNNNNNNNNNNNNNNNNNNNNNTTGACCAAGACCTCCAGCATGCCTTCATCTAC
GAGCTTGAGACAGTTCTCCTGCTTCTCGGCGAAGTTGGCGATGATCTTGGCGATGTGGTACCGCGTCTGGACGAGCGGGTGAAACGCAAACTCCTTCAGC
GACTGCAGCAACTGTGGTTTGCACATGGTCAGGCGAGAACTGTCGTCTTCGGTGAGTTGTGCGATGGCACCGATGGCGTCGATCTTCATGCTGAAATCGT
TGCCATTCAAGATCCCAAACAGACACTTGACGACGCCACGCGCGAGCAGTTCAATGTAGTGCTTGTAGTCGCATTCTGCAGTCATGAACGTGTGGGGATG
CTCAGCCACAAACGAGAGCCGACCAGAACCCGGACTACCAGGTATGGACAAAACGCGGCGGGATGGAGCATTGGTCAGTTGCGGCGGGGCGTTCGTCAGC
GCCGGCCGTCGGTCATGTTCGCGCTCTTTGCAAATCAGCAAGGTCAACAAGGTGAGCACCGACCGTCGGACGCGCTTGTCGGACGACGCGTACAGGTTCC
GACTCGCGATATAGTCGAGCAGCTTGGATCGAATGATGTGCTCTCGGTTCTTTTGGTTCTTGGCGAGCTCGCAGAAGATCGTGAACGCAGTCCGGATAAT
GGTCGAGACCTCGGCAGCGTCCCACGATAGATTCCCGACTCTCGCAGACATTGGTCGTGATGTTGGTAGCGTTTTCGTCTCGCTCTGAACACCAGGCTGA
GCGAAGAGAGACGGCGGCAGCGTCGACACCTGATCTTTTGTATTGATGCTGCGCTTTCCAGAAGCAGTAGAAGAAGAAGAAGAAGAAGAAGAAGAACCTG
CAGCTGAGCTCGGCCGCCTCCGGACAGGTGTCACTGGGACGCTCTTGCTGACGCTGCACGTAACGCTACCGGCGTTCGGCGAAAAGCAGAGCTGCACTAG
TCGTGGGAGTGCGTTCGAGGCCACGAGAGCGTCATGGTTTTCTCTGTTCGTAGCAACTGCTTCAATGATGGCGACGACCGTGAGCGAGATCTGGTACGTC
GTCTTGGGCGAGTCGAGGATCGCGAGCACGCTCGGCAACAGGCGACGTTCTGTGAATCTGCGTGCGTTCTCCGCTTCCGACAGCAGAGCGAGCACAAAGC
CGAGCAGTTCGCGGCGGAATACTGGGTCTTTCTCCAGGTATGGATTGCACAGGATGTCGCCGAGAGTTTCGAAGTGGCTCGAGTGGTAAAACAGCAACCG
GTTGTCCTTGGAAGCGGCCAATTGATGCAGAATCGCAGCGGAGAGCGAGCGTAGGCGAGTGTCTTTGCTGGTGCAAGACGTCAGCATGAAACCGAACCCC
TCTCGCTTCGCCACGGCTTCGCGGGTCGCGTCGATGGTCACGAGATTGTTGACGAGCTCGAACGCGGTCTGTTTGAGCTTGCTGTCAGTCGAGTGGAGTA
GGGAGAAGACGCAATCGAGTCGGTCAGGCGACTCGAGCAGCAACAACTTGACCGGGTTCAGGCGCACCAGCGCTGCCAGCGTCTGCGCGCAGTCGCGGGA
GATGCTGGCGTCGTTCCGGTCTTGAGCCGACCCGAGCATCGATACAAGAGCTCCGAGCGTGCCCATCTCAAACATCATGTCGAGGTTAGCCGCTGTCGTC
ATACAAATGCATAGAGAGCGGTCAGTCCAGGCGACTTCTATGCAGTCGCAATCAGCTCCAGAGACAGCCGAACAGTACCGTTCCTGCTGAGCGAGGCGAG
CGCTGCAGCGGCATCTCGCCGAACTTCGACGAAAGGCGACCAGTATGCGATCTCGATCAGCGGCCGCACCGCCTCAGCATCGACGTCCTGCTGTCGCAGG
CTCTTGAGGACGACCGCGCTCTTGAGCGGATCTCGTTTGCCCTGAGCCTTGAGCTGCTTGTCGTGCGCTTCAAGCTGCTGGCGCCGCGATTC