Description :
From Genome Similarity Track
Location :
Scaffold_366:542- 21586
Transcript NameFunction/comments
Phyag_g5093transmembrane protein, putative
Phyag_g5094hypothetical protein

Sequence
21044 bases(100 bases per row)
TCGGTCTGTGCGAGTTGCTCCCTTGCCTGGCGCAGCTCCTCTGTGAGCGCGTCGTACCGCTCCTTGTCAAGCTTTGACTTGGCCATCTGTCGACGAAGGC
GTCGGGTGTACACATAGTGGTAGATGTTCTCGTATTCGTATTCCTGGTTCGTGATGCTCCACCAGGCATATCCGATGATAGAGACGCCGAAACCAGTGAA
ATACGTTACGGGCTCCATGATATCCCACGAAAAGTGGATAAACGACAACCAGAAGTACAGTCCAAAGGCTCCGACGAGGGACGTCGACAATCCATACGCG
ATGATGTTCGCCTgccgcgtcgccgtcgcctccAATTCACGACGCAAGTTGACGAGCGCCACATGCTCCGGTTCCAAAGCTTGAATCTTGGCGAGCAGCG
CAtctcgctgctgttgaaagAGCTGCGACGACAGCGGTGAGAGTCCAATAGACTCCAAGTACGAGTCGAGGATGCTGCGGGGTTGCAAAAACACCGAGTG
AGTcaagtcttcgtcgtccgactTGCCAAAGTAGAACACGACGCCCGTCTGGTGGAAAGCCCGCAGCACTTCGGGCGCCTGTTTCTTGGGGATGCCTCTC
TCCTGACACATTTGCATGAACTCTGGGTGGCTGATCTTCCACTTGCCCAGTCTCTCCAGGTCGCTGCGTAACATAATAATTGCCGCTTTCTGCGCCACCG
AACGCACGTCCAAGTCCCCATCATCGGCCAGGCTCTGGTATGCGCTGCCCGTGAACACTGGGGCCCTCACAGGCAGCACTTGGTCGTTCAGCAACAGCTC
AAAGTCGTCCGTCAAAACCTGCTGCAAAGTGTCCTCAGGCTGGAACTCTTCTCCTCTGGCCGAGCGGATGGCTACACTCTGCACCGACTTGTCCTCCGCT
TCAATCTGGGCGATGATATCAGCCACCGTGGTCTCTGTAGTTCGTTGGTTCGTTAGCATATAGAATATTAGATAATATACTTTATAGGTGACAATTCGTA
ATAAACTATATAATAACTAGCCTGGTGGAATACTGAAAACCCGTTCCTCGTCGAAGCCGTTTAAAGGCAGAGGGACTGCCAGAGTGCATGTCCCGTCGTG
GTATTTCAGCTCAATAGCGCGTGCCTTTCCGAActgcagcgaggacgagctggcgaTGGCTCGTGTGAGCTGCAGAGGCGGTGACGGGAAACTGGGACGC
GAAAGAAGCCgcgtggaggcggcgctggaagAGAGGAGAGCACGGCGCCACATACTTGGGAGCTGCTTTAGGTTACTTCACTTATCAAGGCCTCAAGCAG
AGACGTTTGCGTGGGTTTCTTTGTCGACGAGGTGGGGGGggggaagctgctgctacgtaTGCTGCGTTCAGTATGGACCGATCTGGATCGACTAAATCGT
CCGGTCGTCCACTCCGAATCAGAAATATTCTCAGAAATCTCAGGCTCGGCGAGCCTGTGTGGCCGAGCCGATCGACTCAATTAGCAGAAGGACGACAGAG
CTCGTCCAAGGAATTGGCGGTCGTGTAAGAGTAGAAGGAGGACAGAAAagctcgaccaactcgactTTGGATGCTCTGGGGAGTGATACAAAGACTTGGA
GATGATATACGAGCATTGGATTGGCGGGCCTAGGAGTCAAGGTCCGAGAGAGGTCGAGAAGCAATGGTCATTGAAGCTGTAGATGCTTGGGCAGGTTCAT
GGACGGTAGCTCGCATCGTCCGAGGCAGATCTGTCCTGGACAAAACCCCATAcacgtcgctgttgctgtccaggAAGTCCCCTGCGGTGCGAGAGAAACG
TCTGTGATCTTCAAAGGTTTTTGCAGTCATTGGTAAattccttctcctttttcgCGTGCAAGCAACCATGGCACGCGGAAAACGCACGTCGCCCTCCTCG
CAGCGCCAAGCTGTGGTCGCCGCGTTGCACTGCACGCACCGAAGCAACGGCCGCCCCAACTACAAGCGCGTCGCCCGCAAGTacaagctgcacgaacgca
cCGTGCGCTagttcgagttcgaggccgagTTCAACATCCCGCAGAAAGAGATGGGGCGGCCCCCAAAGCCGGGCAACACGGCGCTCggcgtggccaagaa
gctgctctgtCTCCCGACATACAAGCGCGAGTGGCCTCTGAGGAGACTCGCCGACGAGATCCACGTGACCAAGTCCACGCTCCAGAAGGTATTGCCACGT
GCCAGGCTCTACATCGAAAACCCCGGCTCGTGCGTGTTCAAGTCGTCCGCGAACGACCCAAAGTTCCACGAGATGGCTCTCAACGACGTCAAGACCGCCA
CCAAGTCCATCTGGGTCACCATGTACTCTCTGACGGACCCAGATTATTTGAAAGCGCTCATCGACAAGCGCAAGGAGTTTCCAGACATGGGCATCAAGGT
CATCATCGACCTCAAGTGGATTCGAGAGCATAAATGTGGCCTGAACGCTGTCTGCGACCTTATCGCCAGTGGCATCGATGTCTTTCATCTGAAGAAGAGA
TCGAAGTTGAACCACCGGAAACTAGTCATCTGCGATGGCCGGTTCGCCGCGACGGGTACATTCAACTGGACCAAGGCGGGGACGCACACcaacgacgaag
acttgACCTACTTGATTGGGTTTGAGCCTGGCACGTTTCTATGGAAGACTGTCAAAAGAACTTGGCTAAAAACGTGCCTGTAgtggaggagaccaagaag
accttCCTGATACACCTCGGTAAATCGGATCGAACCTGTCTTCCCATGCTCTATCCACTGTGGACCGACTTCATCATCCACACGGTTCGTGTAGGGTTGC
TCAGACAGCCAGTTTTTCAAAGTCTCTTTTGGCGTGCCGCCGGcgctctcctgctcttctgcCCGCCAACACCTTGTCCATTAGCAAACCCCACCGAGCG
CGCGCTGCCCCCGAAAAATTCGACCAGGTACTGTGCATTGCATCGCCTGGTCTTAGTTGAGCAGTTCTCCGCAACTTTTAGCACCTGTAGAGCCGGTAAT
AAGGCCAACAAATCGACCGTGGAGATACAATTCCGAGGCAGATCCACACTCTGCATTCGTCGCAGTGCTCGGATGCCATTGACATTTTCCAGCTGATTGC
CCGATAGACCCGACTACGCAAACTCAATGCAACTTGCGAACACTAAATCAACAGAGCTCCATAGCTTGCGAGGCCCTACAACCAACCTGGCTGACGTGTT
CGAACACGCCAACCTGGTCAATACTTCGCAGACGGTTGAGCGACAGATCGAGTGCGTACGCCGTCTCTTCTTTCAATTTGAAGTCGGATGCCGAAAAATG
GCGTAGCTCAATCCTGTTTCCGGTGAACGTTCGCGTCGGTTTGGCCATGGCAACCACAAAAAAACGGCGTCGAGTCGAGTAGCAATCCTCGGATCCTCTC
AAATGGCGTCCTGCCTCctgaaatgctgctgcctgctggtcgtcgccgtcgctgtgGTGGCATCAGATTTGACGCCGGAAGAAGTGCAGACGTGGATGCT
CACGAACGACGCGTTCGACTGGCAGCAACCGGAAGCAGACGCCGTCGTGCAGATCGCAGGCAAAGGCGTGCAGGACGCAGTCGGGAATTTGTACTTTGCA
GGCTCCAAGACGGCCAATATTTCCAACTTTGACCAGCTCAACATTTTCGTAGCTTGCATCAATGCGGACGGAACACTTGGCTGGACCAAAGAAGTGAGTT
AGCAGGATGCTATTGTGATATTGGAAGGCTAGCCTCATTTTCTtctgtctgctgcagtggggGACAGATcaagcagacgcagcgacgTCCATCACAATAA
TCAACGAGACGGACGCAGCGACCGGCACAATGACGCAGTATCTCTATGTACCAGGGTACACCTGGGGGTATCTGGATGAAGGTGGCCACGCACTCAACGG
CTTCGGCCAGTACGGCGGTCGagatgtggtgctggccaagatcaCGCTGAACGGTGACAAGCTCTGGATGCGTCAGGTACTGCGACTGCGGTCTTCTATC
GACAGCCAATGCGATAGTGGACGTTTTAGCTCATGGGATTCTACTGTATTTTGCTGACGCAGTTCGGCACGACCGCGAACGATTTTCCTTACGGGGTGTC
GCTGGACGGAAGCTTTAACACGTTGCTGCTATCGGGCGGGTGCGACACCAACCAAGTGGACGAGACCGTGGAGGTGGATGTAGCGCAGATCCTGGAGACC
AGGGTGCATGCCGGCGCAATATTCGATTACGAGCCGCAGATCATGGACCCGAAGGCAAGGAGTAGTGTGCAGAAGCGAGGTTACGACTTTGCAGTAAGCT
TGAATTTTGACGGAGATATTCTGGACTACACAATGGATGGGGGCGTGACGCTGACaccgcgacgacggcgtATCAGAGAAGGAGGGCTAGTGGCAGAGTA
TGCGGTGGTGTTAAATCGTCAGCCACTTGCGGATGTTGTAATAAACGCCGAAGATGTACGCCTCCTGGACCCAAGTGGGGAGCctgttcagcagctccag
ttttTGACATCGCAAAGCGTCGTGTTCACGCCTGCGAACTGGAACCGCGAACAGTTTGTGCGTCTGACGGCtgtggacgacgtgctggcCGAAGGTAGGC
ACTACGCCGTTGTGACGCACTCTGTGGCTAGTGCTGACCCGAATTTTAATGGCATTGACACTCCTTTTCTGACGGGACGCAATGTGACCGTGCagatcga
cgacaacgaccgCGCTGGGGTATCGCTCTCGAGACAGCACGtgtttgttgctgaaggcgGTGGCAAGGATAGCTACGACATTGTGTTGACGTCCCGGCCG
TGGCACCCTGTGAAAGTCGTGATTCGGCCGCTGCATGGGAACCAAACGGCCGTAGCGCCTGAAGTATCAAACACAACTACGCAAGATGGAACCGCACTAC
TCGTATTCCAGCCTGGAGACTGGGATACGCcgcagcgcgtggtggtgagTGCAGTGGATGACGTCCAGTCCGAAGTGGAGTACGGTGGCCTTTATAATGG
AGGCCCGTTGCTTCACTATACAGAGAGCGAGGACATTCGATATCATACTCGCCGCCCGCAGTGTTTCGATGTGGCCATTTGCGACCCACTGGACTCGACT
GTCTGTCTGTTGACCGAAGCAGAACTACAAAATGGTCAAATCACTATGAGAGTGTGTGACATTACGAACGAGTGCTCCTTTTCACTCGGAAATGGCGCGT
GTATCGCCAACGTGATGACCACTACTGGACGAGTACCAGCCCGGTTTGGCAATCCGCCATTAGACCCTGGTAGTAAGGAGACAAATCCGGCTGATATGAG
CTACACAACGCTTCTCGGTTTGTTGAAGGCGGAAGAAAGCGATTTTAACCTCACCGCTTTatcagcaacttcaggaTCTGGAGCCACCCCCGGCATGGAG
TTTgtaccaccaccaccagagcTACGGGGGTTTGTACTAAGTTTCCTTGGGCTCATGAATGTCAACCAGGCTCGGAAAATGAGCGCTAACCCGAGGAATG
TCCTTCACACGATATGTGCGGGGTTGGTACGATTAGAGACCATGCGTTGGGCGTTCGAAGAATGGCCTGAGGGCTATGTGGATCGCGTGCTCAATGCTAC
CTTCGCCATGTTCCCGCAAAGCTACTCGCTTCAACGGCATTCCTGGAACTGCGGCATGGCTAATTTCCTTCCCGATAACAGTGTTGACGTGAGTATTTGG
GATAATGACCCTGGCGTCACACTTTCTACTGCGCAGCTGGATGTTAGTGAGGGGGATACCACAGGCGCCACGTACACTATCGTTTTTAACGCACCGCCAT
CTATCGGAGATCAAGCAACAATTGCTGCAAGCACGGATATGACACAGACGTCGTCTGTGTACTGTACGGCCAAGCAATCGGATACGTGTGGGTTTTGGAA
CGAAGATTTTGCAGCGTTGGCAGCTACGATCTATGATCAGTCTGCGTGGAGTGGAGCCATTGCACCGAATGTGAGCATCGCGATTGTTGGGAACTCGCAG
GTGGAGATTTCGCCCTCACTCTTAACATTCACCGCCTCAAACTGGTTTGTGCCTCAAAGTGTTGTGGTGCGTGCAGTGGACGATGCTGTGGCAGAACTCA
ATGCCAGCTATGTAATTACACATCGTGTACAGAATTCACCCTACGGCTACACGAATGCGACTGCGTTCTGGTTCCAGGGCACAGTCGCGTCGGCTGCTCT
CGAGCTTTACCCTACTTGGAATACTGTGGGTGGAGGCGCTATCCCTTACAATCCGCTGCCGGCCGTTCTATATGCACCTAATCACATGCGTGTTAATGTT
TTCGTGCGGGATAATGATGAGGCGAAGGTCAATGTCGTAGTCAACCAGCCCGAAGCGAAGCTTGCAACGAAAGAGGCGAGTGACGCCATTAATTGGGTGG
GGGACTACGTCACAGCGCTGGCATTCCACGACGTATCGGTGTCAAAAACGACAACATTGCAGTCGGCGCTACAGAATATCCTCGTGTTTGCGGCAGGTGT
GAAGACGTTCATGAAGTTTCATCTACCGCGCTTGCATGATGGAGATATATCACTCGCTTACTCGGGTGCGAAGCTAGTATTCCATCAAACTCCGTACAAG
ATTTTCAACGTAACGGAACTCGATAGTAGCAGCAGTGCTTCATCATCAGATGAAGTGAGCTTTACGAAGGAATATATGCTGAACGTGACGATGGTGGACA
ACACCTGGACGACTGACAACATTCGCAGTGGAAATGCAACGCCCCAGCCTCTTTCGTTCGTGACGAATGGTGCGTCTATGACGGTCACAGCGACAGTGGA
GAAAAGCCGTTCCATTGAGATAGACATTTCTCCCCTGCTAAAGCAACTTTTACCTACGCGACTATCCGTGATCTCTCTCCAAATTGAAGTGCTCTCAGAA
GGAGGCAGTGCCGAGTCGATAGCTGTGACGCAGTTGTGTTCGTCAGTATTTGAACGCGAGCTCCGCCCCCTGTTATCCCTCGTGTACCAGTTCCCGAACC
TTCTGAGCGGCCTAGGAGCCACTCAAAGCTCCACTGCCGTATCTACGCTGACCAACACACCTCTATCCGCGTCACTTGCCACGAATGGGGCCAAATATGA
CGATTCGATTAACAGCACCGTCGCAGTGGCTACAACTGAAAGTGAAAGTGAACCGTGGTGGGAAGTGACGCTTCCTCAGCTAACAAAACTGGGGACGTTG
GTGATTTTCCTACCTGCATCTGCTATCCAAGAGAACGTGGGCTCTGATACTGTCGACATTGTGGTAATCACATCGTTGAAGGCGTTTAATGCCAAACCAT
TGTCGCTCGATGATGCTCTGGCATACGGTTGTCCGGATTCATGCCCCCATGTGGAGCGTTTGCCGGTTCGGAAGGGTATTCTGCTCTGGGATGTACAAGC
TGGTGCCGTTGCAGTGCGCATCTACCGCGAGGGTATCGGATCGTTGATGTTATCGCAGGTGCAAGCGTTTAAGCCGTTCATAGCGGTGACTCCCACTGCG
GATGGTACTGGGATTCGTTCTCGACTCAAGTTGGATTGGGGTCTGAACACCGCGCTGTTGCAACCGTGGCGTCTTCTGCAGACAGTAAGGAAATCTGAGA
ATGAGAACCTGGCAGCTGGGATGCCAACCAGACAGAGCAGTACAAGTCCGAGCGATGCGTTATCTTACTTAGCCGTGGACGGGATAAAACATACTAACTG
GGACCCACTTACTATCCAGGATGAAGGTGACAGTACGATGGTCGCGCACAGTACACGAACGGATGTGGAAACAGATCCGTGGTGGGAAGTCGATCTGGGA
AACGCTAAACCTGTTCACTCTGTGGTGCTCTACCCGTATGTGGGGAGTCATTACGACGAGCTTTGTGCCCCAGAATCAGCGACATTAACAGGAACTAACG
GATATCCAGCATGGACTGGCGATCTGTACAACTACAGCCATATGgatccgttgctgcagctcgacttGCCGTTTGTTCAAGTATTCGATGTGCTTCTGTC
CGACTTACCATTGACAAACAGCGACGGCACTGCGACTGGAGCTACCGTTACTTCTAACAAGACGCTGGTATTCTCGTGTGCCAACTACACGAACTCGATT
ACGTGGGATAGCGTGCTCTCGACAGGTCGGTTTGTGACTGTACGAAGGCGCGGTCTCGGCGTGTTGATGCTGAATGAGGTGGAGGTTGTTCGCTGGAATC
CAGCCACACTGTCTCGTTACCTGTTGCTCGACCTGTTTGGTTCCGGTGCGGAGCCGATTGGACTTGCTAGTGTGCAGGTATTCCCACCGAGTGATGTAGC
CCCCTCGGACGCAAAAACGCTACCCATACCAACTCCGATTTCGTACAAGATCTACAGTGTAAGCTCGCAACTTGCAAGCACAGGTGCAGGTTCAGCGAGC
GCATTGCTGAACGCTAATGACAACACCTCGTGCTACGTGGCTGGAGCAGCATCTTTCCACGAGTGGATCGTTCTGGAGTTCGATCCGCCTGTGGAAATCG
GACTTGTCGACGTCAATTCAGAGGTGGGTCAGTGTTCGACTGCAAATGTGGAATCTGTGGCAGAGTTCACCGTTGCTTCACATGGCGCTGTGCTCACGGG
CATCCGTAGTGACGCTGCATCACAAGCGTTAGCTTTAGAGGGCGCTTCAACTACTTGTGCACTGAGTGCGGCAGGTGCTGTTATTACTCCTTCCTCGCAG
TGCACAAATTATGTTTGTGTGGACAATGAATGCCAAGCGCCTTTGCGAGTCCAGAATGCAGTCGGGAGTAGTTTGGTTCTCAGTGATTTCGTTGATATCA
CGGTGCTTGGTAAAACTGAGCTGCTTCCTGTTAACCAGCTCCCGTTGTCAGTAAATGAACAccgcgcgttgctgctgcgtgacaGCCCAGTAGTCATCTG
GTCGTTCGATGATACCACCAAAGTGCTTGTTAGCAATGACGAAGGTGGGGTATCGTGGGGAAGAAAGAGCCGAGCAACAGGAGCATTGCAGCTGCCAACT
GCTTTGTTCTCGATGGATCTGAAGATTGACGATGACCTGGAATCCACGTTCTTCTCAGCCGCAGTCACAGTTCAGCCTGCGATGAGTTCGCTTTCGCTGG
AGTTCTGGTTTTATATTACCAAGGAGTTTATTGCTGGTGCGGCGGCCAACTATCCCGCCGAGACGGTCACCATGTACGGCACAGATTCCAATGGAGACCA
AGTGACCTTCGGGGATGTGGGGATCAGTAGCAAAACCGCGAGGTTCTACTTCGCGATGACAAATCCTTCCGATGGGAGCGTGTGTAGGACAGATCTTGGT
GACGATGCCAGTGTATTACCATTTCCCGAGACGTGGCATCAAGCTGTAGCCACGTACGACCCGACTTCTTCGAGTATATCTCTTTCAATTTGTGTTTCGA
GTGGAGTGCAGATGGTCAACTGCTATTCGAGTTCTGTGACGTGCAGAATGGCTCTGCTAAGTCTTTCGCAGAAGACACTTCGGTTCGGAGCTCCAGGTac
tggtggcggtggatTCGTAGGGATGCTCGCTAGTGTATCGTGGTTCGTTCGAGCGCTAACGACTAGGGAGATCATGGATCACTATCACGATTTTCTCGAT
GGTGTGTCCACTGAAACGACTGCTGCTCACAACACGTACTCGATCGAGTTGTCAGCCAAGCCGTTGCAGCCTGTCACCGTGACAATCAATGCAGAGAGTG
CTTGCTACCGATTTAATTTGTGCAACGTGTCGGTTATCCCATCGGTGTTGGCGTTCACAACGGAGAATTGGAACTTGCCCCAACTTGTCCACGTCCTCGC
CACGGACGACCAACTGTACGAGGGCTTGCATACGTCAGAAATTTTCCATGTGGCGTCAAGCCCACCGTCCTATCAGCTTACGGCTATGGCGAACACTACC
AGCGTGAACAATGCCTCGGATGGCCAACAACTTTTACAAGACCTTGATGAAACTGTGACGCAATTTTACAGTGATCTGGTTCTCTACCGAGTACTCGAGA
ATGCAAGTCAGCGGCTGACACGGCAAGACGGTCTTGTAGGGCTACAGGCGCAATGGGCCACGCAGCTTGTAACACAAGTCGTAATTTCTGCCAACGCGTA
TGCTCAGACCATCCCCGTTCCGCCTGTGGTGGCAACGATAACAGATTTGACGGTGCCCGGGATTGAGTTGTCAACAGTATCACTGAGTGTGTCTGAGGAC
GGCAAAGGCAACGATTATCAGGTGGTGCTTCTTTCAGAGCCGACGGACAAGGTTCGCGTGACTCTACATATCGCTTTTGGTTGCTATCGTCGCTGCGTGG
AGAGTCCTGTGTGTCCATCGCAGACGGTTGAACACGCCGATGGAACGTATGCTGTTGCAGGAGACAGCTCATTCTTAAGTTGTGGAGACGACACAGAGAG
TATGAGTACAAGTACGCTGTTGTGCAACATTACAGTGTCGCCTGACATTCTGACCTTTTCGCcgagcgactggagcttGCCAAAGACTGTACGAGTTCTC
GCGGTCGATGACCAtctcgatgaagacgacgtgcACTTGGCCATTATTCGTTCGACCTCGGAAAGCCTCGATCCTGTCTATGACGCTCTGGTGCTGCCAG
ACATCGTTGTGGCCGTTGCGGATAACGACAACACAGACATGAAATACTCTGCAACGCTTGTTTCGCTCACTGAGAAAAGCCTGGCGCAATCCGCACTCAA
GTACCCGCACGCTGGTTCGTACACGCTTCAACTGCTGACCGAGCCTTACGCCAACGTAACCATCGCAATGAGCAACGAAGCAAATCAGGCATGCTATCGT
CGATGTGGTTACCCCTTTGACGGGGCCTCATGTGGCCTTCCTCGCCAACAGAGCGTGAGTCTGGTACGTCTGCGCTCAAACTCAACGAGGGAGATTCACC
AGATTTCCTTGAGTATGACCAAGATCACCGAAGTGCAGCGAATTGTGACGTACGCGACTCATGTGGACCAAATTGTTTTGCTGTCTGTGTCCGGCGGCTT
TGGTGTGGAGGTTCAGGCGATCATTTTTCAGTTCACTGACGCGTTCAAAACACGTTTCCCGTCTGCTAACGCCATCACAGCTACTGCTAGCTATGGCAGC
ACGTTCACCGTCACAAATGGGGCTGGCACCACTACGGCAGCACTTGATTTGTTTTCAACAGCTCAGCAAGTTCAAATTGCGATCAACGGACTATTTCCTG
GCGCAGCCAACACCGTCAACGTGACGCAAGGCGTTCAATACGCAGCATCGACTATTACTTGGAGTGTCACTTTCCTGCGATTTGTGACTTTAGATGGCTC
CTTTCCACTCCTATCTGTAGCGACAAATGGAGTGATCCAAGGCACACTAACATGCCAACGCAATCGAACGAGTAGCTCACCTAGTGGCACGTTTAACCTG
AGCTACGGAGCTGCTGTATTTCAAGTGCCAATCTTGCCaaccgctgctgccgttcaAACTACACTGGGTTCACAGCCAGGGATTTACACCGTGTCCGTCT
CTCGAAGGCTACTGAGTCTCGGGGGCTACGGATTCGAGTATGTCATTACTTTCGTGAGTGTGGACACCTATGCGAGTCTGGTAATGAATTCTACGACCAG
TGTGGTGGCTTCCCCAAACGCTACGACCCAAGTGTCGATCTCAACAACCGAAACACAGTCGCCAGTGTTGATCGGTGGGGCTTTTGTCATCGATTACTAT
ACTCCACTCAACATCACCACTTCAGTCCTGCCCAACCGTACCGTGCCGATCTTTTGGAACGACTCGGCATCCACTCTGGCAGCCAAGCTGATGCAGCTTC
AAGGCGTCGCGAATGTGACTGTGTCGCGCCAAAAACTTtctgcagaaggaggaatGGCGTGGACTGTTCAATTCCTACAGAACTACGGGAACCTGCCTAG
TATGATTGCAACGTCACTAAACTTGACAGGTAAGGGAGTCACGGTCGGAGTGAGCACTATGCGAGACGGCGAGTCTTTGCGGGGGAATTTCTCCGTTCAG
ATGGGTGGCTGGTTCAAAAAGACGGACCCGCGTACAGGCCGTGCATACATGGTGAACATGACATTGAAGAACACCACGTCCATGCTATTCAATTCATCCG
CTAGACACCTTCGTAAAGCGCTTTTTGCGTTAAACATTACGGAGCAAGCAAACGTCTCTCGTGCTGGTGTCGACTGCGATATTTTCAACGTCTGCAACGG
ATACACTTGGACGATCAGCTACACCAACAGTCCGGGGAATCTCCCGCCTATCACAGTGTTTGCCGATGATACCATGAACCAAGCTCCTGGTATGACTctc
acctcctccaccattGCGAATGGCACTTACTTAGGTGGCAACTTCTCCCTGcgactcgaactgctcgaTCCGACTACTAATCAGACATACGTTGGTACGA
CCTGGAGATTGCCCGTTAATGTGAGCGCAATAGGGATGGATGAAGCTTTGGAAGCGCTGTCTTTCGTCCGCTCAAACCGTGAGGCGGAATATGACCCAGA
AACGAAGGTATGGCGCGGGATCAAGTTTGATAAAGGTGTGCGTGTGTATCGTGAGGGACCGTACCTTGATGGAGGGCATATGTGGAGACTGGAATGGGCG
TTGGAAGACTACTTGCGCTTTGCCGATCTGAAAATCACGATTGACGTGTCCCTCGTGACTCAAGAGATAGAACCTCTACCAGTCCCATCGCAGCTCGATC
TGCTGGGCAAACCAAGATGCTCGGCGATCCCTACCGCTATTTTCCAGCCAGATTTGACTGACCCGCTTGGCCTCCGGGGTTTTTGTGTGTACGCTATCGC
GAACGAGACGGCTCAGGAACGATTCCTTTGCAACTATACCGTATTGGACCCCTGGATCGTGTTCACACCAGAAAACTGGTGCGTTCCGCAGCAAGTACAG
CTGGCAGCCGTTGACGACAGCCTGGACGAATACACCCAGGATAATGGCACGGTGACATATTCCGAGGTGACGCATAAAGTGTTCAGTGACGACTACATCT
ACTTGGCGCTTTCTCTGCATGACGTGACGGTTAAAGTGGAGAGTGACGACGTTGCCAAAGTGCTTGTGTCTGAATCGGCACTTACAGTAAGCGAGGACGG
AACACTGACAGCTCAGTACTATTTGCAGCTGAACTCAGAGCCCCTAGCTAACGTGAAGATCGTTGTCCTTCCTTGGCTAGACAACAATAACACGCAGTGC
TACCGGTTCGGCTTGTGTAATGTCACACTCCCGGTAAGCGAGTTCGTATTCACTCCAGATAGCTGGAACGTGCCGCAGACGGTGGCAGTGCTCGCTACCG
ACGACAGCCTTGACGAGTACGATACGCACATGACTGGCATTTCACATTTGTCGTACAGTGCTGACCCGAAGTATAACGCGATTGCTACGATCCCCAAAAT
TAATGTGACTGTGTACGACAACGATGTCTCAGGCTTCGTTGTTAACAAGACCACCGTGTTCGTGACTGAGGGCCTCGGAGCGATAGATTCGTATTCTGTC
GTGCTGGCCACGGAGCCGTTCGCAAAAGTGATTGTGAGTGTCACTGACATCGGCACGGTAGGGAACTTTGCCATACCTTCCCCCACTAAGCTGGTTTTCT
CGTGGCGCAACTGGAATATTACGCAAACGGTGAACGTGACAGCGTTCGACGACCATACTCAAGACCCTGTGCCATCCACAAGCTTCCTCAATCACTCACT
AACAACAAACGACCTCATCTACGCTGGGCTACGAAACTTGACAGCGGTGAAAGTGTTTATCACTGACAACGACAAGTCGGGGATCGAACTGTCAACACGT
CAGCTGCGCGGGGTGGAAAGCAACTCCACTGTACTCTCGTACGGTGTTCGTCTAACGTCGGAGCCGTGGTTCCCCGTGGTCGTTCAACCTAACGCCAGCA
ATGACTGTTATCTGCGCGTCCAAAGTGCGACGCGCATCTGCAACGCCAGCTTATTGAGTGGATCGACTTCGCTGTATTACGGAGCAGCCAACTGGAGTGT
CTGGCAAAATGTGTCTCTTATAGCAGTCGACGACTGgctggacgaagccgacATCCACACGGCTCGGATTTCCCACGCATCGTCAAGTCCTGACCCTTTG
TACACTGTCACCGACTATTCAGCAAGTGGCGGGGATATTACGTTCTACATTACCGACAACGACATGTCTTTCGTGAACATTTCGATTCAAAGTGCCACCA
ACCAACTGCACGTTGCTGAAGGAAGCTTTAACGATTCCTACAGCGTTTTCCTGAACTCGGAGCCGTACCAATACGTGACAGTAACATTGTGTCCTGCTAT
CGAGAAGATCGTGAGTCTCGCCAACTCATCAAGCATCTTTGTTCAACCGCAGGTCGGAACTGCCTTCGgttcgtccacgtcgtcgggtATGACCTTAGTG
AGATCACAGGCAATTCGCAGCATTCAACTGGTCCTCACACCTCTGGATTGGTCGATTCCGCGAGTAGTGACAGTATTTGCAATTGACGACGGAATCCCCG
AAGCCGCCACGCAGTATTCATCGATTCTTCACTCGGTGTCAAGTGCCGATGCCAACTACAATATCTCCAACAGTTCTATCGGAGTCGTGAATGTATCTGT
GATGATTAACGACAGGGAGGCCATTCCTCCACCACTGCCGGTGACTGCCATCTTTGACAGTTCAGGCTCACAGATCAACATCGCCTTCGACTCGACGGTC
TACCATGCGGCCACCATGAATGTGAGTTCCTCTGGTACATACGTGACTCTGCTCAAGACTTTCCCGTGCAGTCTCGTGTTCAACCTAGTTGCAGCAAAGT
ACACGCTGGGTTCCCAGTCTGATTGCTTGTGGATTGACAGAAAGACTCTGCGCATCGAGCTTAGCGCAGGAATGACGATAGCTGCGGCGGACAAACTAGT
CTTGAACGACTGCAGTTCTTTCGCCAACCAAATCTGCAACGCCACGACTGTGCTTCGAGCTAGTCCTTCAAGCCGCGCATTCTCCCAGGCTAGCATTGCA
GTGCAGGTTCCGGTGGATGTTGTCCAGCCAAATGGTGTGCTCGTAGTCCCTGAAAACGTTGGCAGCTGCGGGACATGGTCTGCAGATGCGTCTTTCTCTa
gcggagctggtggacggcCATTCGTACAATCGATCTGGTTCGCTCTGCCCGCTTCGTTGTATGCATCATCAATCAACCAAACTAGTGCCGGAGCAGGGTT
GGCGTTGTTCCAGAGACTTGATGCAGGCCTTGCTCTACTTTGTCAAAAGTACAAAACGGACTGGACGACTGGCACGTCGACAATTACGCTAGTACCAGCT
GCAGACATTACTCTGGCCATCGCTGCTAACAGCAACGCCACATCGGATTTTGCGACGCTTTCTACCATGGCGCAGCTTCGCTCGGCTTGCTATCTTCGAT
CTGTTGCGCAGAATTCTACGACGTCGGGTGTTTTACTCCTTCAAGTGAACGGTTCTCTGCTGGAACCGGGTACAGGGTATCGTATCGGCTTGAGATTAGT
GAATGCCTTCGCCCAAACAACGGCGGTCTCCAGGTCTGTCAACGTACAAAGTTTACCAGGCCCCGCCGTGTTCGTCGTGGGTGCTTCTACACAAACCGTG
ACAAGAATTGGCGATCCCGTCGTGATACAAGTGGATTCGGTGGTAAGCTGCCCAACGTTATCAAGTTCGGATGTTGCGTACCGGtggacagcaacaagta
gaagcagcgacggcacCGGCGCAGTAGCTACCGAAGATTTCAGCAAGGACAATACCGCTCGAGACCCTCGTGTTTATCGCATACCACGTTCATCGCTCCA
GGCTGGGCTAACGTACACTTTCCAAGCCGAAGCGTATATGACGGGGGTAGCGGCCAACCagtcgtcgagcagcttcgctTCTATCATGGTGAATGTCTCC
AGTAGTTTGCCTCAAGTCTCAATTAACGGCGGAAATTGCGCGCTTGGCAGCCTAGACACTCTTGTCCTCGACGGTTCATCAACTGTCGATCCAGATTTTT
CAAGTACGCCGTTCACATACGCGTGGACGTGTCAAGACGTGACAAACACAACCAGTTCAACTACAAGTTCGTGTATGAACGCGTCGACGACACCTTCCGT
TCCATTGGTGCTGAACTCCGCGACGAGTCCTGTACTACGGATCGCACCGCTGAATCTCGTGTCGAACCGCCAGCTTCAATTCTCGTTAACTGCGTCGAAA
GGCTCGCGTTCGGCGACAGCTTCCTCTAACATTTGGACCGTATCGGGACATCTTCCGGTTGTTGTAGTCACCGCGTCCACTGCGAAAGTCAATCCTTCGA
GCCGTTTAACGCTTACTGGTTCGGTGACCTCGGATTATCCGTACACTACCCGATGGGTGCAGACGCTGGGGAACCTTGTGCTTCCTACTGCAGACGTAAG
CAACACGAGCGATGCCTTCACATTGCCGCTGACGAGCGCAAACAACGCAATTCGCAGTTTCAAGCTGACGCCGGGACTTACGTACACTTTCCGGCTTGTG
GCTACTGACACAGGAGGCAACGCTGGCTTCGGTTCTGTGTCAGTGCTTGTGAActcgccaccagcgtctgGTACTTTTGTAGTGAGTCCTAGTTTGGGCT
ACGCGATGCAGGACGTGTTTACATTTACCTGCTCGCTCTGGAGTGACGATGCGAGCGACTATCCTCTGACTTACTCTTTCGGAGTGTTATCCAGTGCGAC
CTTCAACGTACTGCAGAACAATGCGACGGATTCCAACGCTTTGGTGGCACAGCTACGGAAAGCTATGAcgccgttggtggtgaaTCAACTCACGCCCTCC
GTTACAACACAAATGTTCCCCCCTGAAAATATGGCGGACAGCGAAAACGTGACGATCCTCGCATTTATCAGCGATCGATTGGGTGCGATGGCGCTCGCTT
ACAACACCATCGAGGTGCTATTGCCTGAAGCAGCCAAGACGTCGCCCACCGTGTATGTTTCCAACATGTTTGATGCTACTGGGGTGCTCAAGTATAGCAG
TGGGGCGTCCGAGGACGTGCATcaggcgctggctgctgcattggtgctggagaaagCTTTCggaccttcttcttcttcgtcatcgtcatcgtcatcgtca
tcgtcatcgtcatcgtcatcgtcatcgtcatcatcatcgatTGGGTTGACAACAGGAACACGACGCCTTGCTAGTTGTCCGGATGGATTCATGGGAGTCA
ACTGCGCTACAGAGATTGTCATAGTCCAGAAAATAAACGCCTTGATCttggcgacggtgtcgaATGCAGTTGGCTCCGTGGAAGCCAGTAGCTCGGAACT
TGGACAGGAAGCTCGTGTGCTCGGCTCTATCATGCGGAGCACACCTGAGGCGCTGGGCCCCGCGGAGATCAGCGTTATAACtcagctcagcagcggcatT
GCGGGTAGTGCTCTAACGATTGACACTCCGAGTGACTTCCTCGATTCGACAAGTGGCATTCTGCTTGAAGTGATCGCAGgccttctcgcgcttgaaaGTA
CTACCAGTAGTGTGAATACGCGTCGACTAGGAGACACGAACACGACTTGCACAGAAACGACCAACGCTATTGGGGGGGAAGTGAACTGGAACAACGTGGT
GCGCACGCTTCAATCGCTAGCGGCGCTAAGTAGTGACGGGTTTCTCGTTGATGAATCTCCCACAGTACTGGAAGCTAGTGGCGATGTACGCACAATTTCT
TCAAAAGGCGATACTTTCACAGAATCGACGAGTGGAGTGTCGATGAATCTCACGACTACTTCAATAGCGTGTCTGGACCCGGGACTCTACCTGGATGCCA
TCTCACTGGTCAAGAGTCCGCACTCTGCGTGCAGTCTCAACGATTCCGAACCAATTTCTCGATTAACGGTGTTTTCCGCGCACTCACAGGCTGCAGTTGA
CAAGTCTGCTACTGTTACAGCGTACGCTTATGACGCTGGGGTTGTCATGCAGACGCTAGCTAGTACGAGCGCCTGTGTCAACAAAGCTTCCGAGTCGATG
CGTCGCCTTGAGTCTGATGATACTGAGACTGAGAAGTGGGTCCCTCTGGTTGCTCTCACAATTCCACACGATCGTGAGCTATCACCCATCGAGCAGAGAA
ACTTCTCCACAACTTGTCAAACATGGGACGCTGAGGCTTCGAGTTGGGCTGTCGACGTGTGTTTCAAGGACGACAGCTCTAGTACGAGTAACTTCACAGT
GTGCTATTGCACACAGATCGAGTCGGCtctcgaggtgctggtgacgctggaagAGCGCTTGGACTTCTATGCGATGCAGCCCGATTTGTATCGAAATGAT
GAACCTTCCCTCGTTGTCAGCATCACGCTCGCTATTCTGGTTGGTGTGTTTGTGGTTGTCGCGAAGGTCGGTCAGAGCCTTGACGCGCGCGATGTTAAGC
GCGAGAAGATCATGACGGTCAAGAGGCTCAATCGCGCCAAATGGAACGAATTGGAATCCCGGACGCAGATCCACAACGTGTTTGAGGATTTCGACGCGTA
CTACGTCgcccagaagaagaaacgattGGAATCTCGCCCTTCCGAGGCACCGACGGCAGTGACAGACGTCGGGGAATCGTCAGCAGTATTATTTTCTTCG
TCCGTCCGTGGTCAGCGAATGGAAGGACCAACCAGCCAACCTTTTGATACCAACGTACAGCTACCGGATGAAGCACGCACCCTGTTCGGCTCGTCAAACC
TCATGGATAGACAGTACCGATGTGTGACTTTGCTGTTCCGAATGAGCAACTTAGCGCTGGCACTACTGGGgattcttctgctgcttgctggaATTGAAGT
GCAGTTTGTGCTTGGACGAACACCTGCCGAATTTGTGCTCTATCTGTACAGTGGACCGCTAGGAGCCACACTCATGGTGGGCGGAACAGTGTTGATGGCA
GGAGGAATCGCCGGAGTTTTACTTGCCCGACGAGATGCATCAAATGCAGCTCGGACAGCGTACTTGACGTCTCTGGGGTTTGGCTTGCTGGCCCAATTCC
TCGTCGTGATGTTCGCGTTTCACGTGCTGGAGAATTTTGCTGCCATGCCACACGATGTGGCACTGGCATTGCGCTCAAAATGGGATAATCTATCTATCGG
TGACAAGACTCAGCTTCAAGCGTCGTACGGATGCTGTGGGTTCTTGTCCGTTAGTGAAGAAGTATCTTGTCCAGAAGAAGCACTTGATGCGGTACCTCCC
CGAACATGCTCGGTGGTTCTCGGGGAACAAGCATCTTCGTTGTTTTCTAGTTCGTTTGTCTATGTGGAGACTGTGTTGTTCGTGGAGATCGCATGTGTTG
CGCTTGCCAACTTTCTCGTTCGATGGCGCCAGATTCGATTAGTACAACTTGCTACCAGCGGACCCGCTGCCAATGCCGAGGCGACCATCGTTCGCTCGCT
GGTATCCGCTGCGCTCTTGTGCTCATTGCCACCGCTATATGCATTCTTAgcctgtgctgctgttggtgcgGTGATCTTCGGAGCTGATTTGATGGTACAT
TGGGGCACACTGGCTGATCCACTCGTGTCCGCGCTGTTTGGTGTCGAGGTCGGTGCGTTTATCATTTGTGGAGCAGTTGTATTCCTGCTCATTACGTTGT
TGGCGTTGAATGCGTTGGGTAGACGAGATGTGCGAGCCCTTCGTTGGGTTCTCGGATTGTCCCTGGTCTTTTTGTTACTTACGGTAGCAGTACGAGCGTA
TATCGgacgtcttcttggcgattTCTACCTGGACCCAATGATCAGTAAAGCGATCGAGGCAAAGTATGTGGCGCTGCCGCGATCAACGACACTTTTACAA
GTGGAGATGGAGTTGGAGTGTTGCGGCTTTAGTGATAGCACACAAGGGACTTGCGTGGTAGGAGCATCAGACACGGACATCCCTACTTGCCGTGAGCAGG
TAGAGAATGCACTGATGCGCGCTTTATCCCTGGCATCGGATCGTCTCGCAGGGTTTGCAGTGGTGCAAGCTGTCGTATTTGTTTTGTTGGtttggttgtt
gttgcgaCTCCGACGCTTCTCAGGTCTGGCAGCAATTCAATCAGCCGATCATGTGGAACCCACAGTTCCGGAGCCACCAACGCTTTCTGAAAAGGTTTTT
GCTAGTGGACTAGCACTGTTGAATGtgggagctgcagcggctggtATTGGTATCTTTGGCCTGGGACTTGATGTGCTCTTCGAACTCAATGTGCTGCAAA
TATCGTATCTACTGCGTGTGTTTGACCGTCGTCTGGGCGTTTACTTGCTTATCTTTGGAGGTATGATGGAAACTTTCGCTGTGTGTGGTGGCATTGTAGC
GTGGTTTGGGGCGCAAGGTAACccacgacggccaagaaTAAAGGCTGCTAAGAAGTGGCTGCTGACTTGCTACTCGTTGGCGTGCATTGCTCTCTTCATA
GCAGCGTTTACCTTGGCAGGAGTTGGGCACAAGCTGTCGGCGCACTTTACTCTTCCGAGTGGTGGGGATAACGCAACAACAGCCAGCGCAGTAGCAATCG
ATACCCGGATGAAGGATGTATGGAACTCAGCCCCGTCCACAACAAAATTGTTCGTGCAAAACACTCTGACGTGCTGTGGTTACGAGCGCGTTGAAACTGG
AAACGGATCAGTGTCGTACACGCTGCAAGCTGAACAATTTGGTTGGCGGCGTCTCACCTCGACGAACACTTATGTCGTGTACAATTCAGGAAGAGACTTG
GAAGCCCGGAAGACGCGTATGCTTACGGAAACCAAGGCAGAGTCAACACATTTGGATAGCAGCCCTCAATGCCCCACTGATGCTTCCGATGGTTGCGCTT
CCCCTATGAAGCACTACGTCTCTCGAGTGGCTCGCATCGCATGGAAACTATGCAGCGGACTAGCTGGCTTTAGCGTTGCAGCATTGCTCTGCGCCAGCGG
ACTACATAGCAACAAAACGCGTGAGAGAAAATGGCATTCTGGTTGGCGACTTCGCGTTAAGCGGACGTCGTTGCTCGTCGCAGTTCTAGCAGGAACTTTA
GCTGCGCTAGCTTGCTTTGTTGTGGGCTTGGATATCGCTGTCGG