Description :
From Genome Similarity Track
Location :
Scaffold_695:542- 1933
Transcript NameFunction/comments
g12083.t1RAW28644.1 hypothetical protein PC110_g14981 [Phytophthora cactorum

Sequence
1391 bases(100 bases per row)
AACTCAATCTTGCCTCCTGCAGACGATCGCGGCACCCACATGAGCAGCGATCCTCCACCGGAACCCGGCACATCCAGAAGCCCTGGACGCCAGCGGTCGA
GATACAGCGTTTGGTCCTGAAGAGCCTTCACCGTCGAGTTCCACGACATCGTCTCGCCGCTCGCCACGTCCACCTCAGCTACCGTGTCACCGCCAGAGTG
AATGACCACCGTCACATCTTCAGTGTCAGTGCTCTCGAACGTTATGTTCACCGAGCCATCCCCAGATTTACTCCAAGTGCCGCAGCTGCCGTTGAAAGCC
TGGTCTTCCGTTGTGAGCGCTAGCGCATCTGCCAAGGAGCCATCATCGATCTCTCCGACAAAGGACGTAGGTCCGCAGATGGGTTGGATGAAGGTGGCCA
TCATGTCAGCGATACCAGTCGGATCGAGCGTGGCGATGACGTCCAGGCCCATGTCAGCCACCGACACAAGGTAGTCTGACGTCGAGATCGCGTTTCCGTC
ATCGTCCACTGCTCCGTCAGCCAGGCCGTCCGTGATTGTGCTCATTACTGTGCGCAGGGTGTCTCGTACACTGAAAGCATCGTCCGTGAGGTTGCGGATG
CAGGTGTTGGTCACAGCGGGAATATCCTGAAGGAAGAGGTCCGAGACGCTCAGAGCCTCTCGGATATTGCTGACGGTGCTACTGGGGTCCTTGGTCTTGA
TACCAGCCACGAACTGCGTCACCTTGTGGATAATCGTCTGCAGCTTGGTGCCGCACGTTGTGCCCGCCGTTAGAACGTCTTGGAGCTGGGCGACGCTGTC
CGTGTCGAGGTCTTGAACAGAGTCGTCAACGCCAATGTCGCTCATGAGCGCCAAGAACGTACTGGGGTCAAGCAGCGATGCTCCATTCTCAACCACCTCC
GTAACAATCTGGTTGACGGCAGCAACCACGTCAGCACTGAGCTCCAACGTGTCAGTAGACACCGGGAGTCCGAGGCACGTGCAGACAGCCGCAGGCAGCT
CGTTGATGACGAGATCCGACTGGTTCACCACGCTCAGTAGCTGCTCGCTTTGCGTTGCGTTAGCCTGGAGCTCGTCCACATAGCTCACAAGGGAGCTTGT
GGCTGCGAAGAGCGACTGGCCGCACTTGACACCGAGCTGCAGGGCTTTACTGGCCTTGATGAACTCGCCGAAGACGCCAGCCGTAGCGGCATTAAGTGCC
ACCGTAGCAACCGACGTGACCTTGTCCAGGACCTCGGAAGTGCAGTCCGAACTCTGTGGAATACACTCCGCGCCGCACTCAACAGGAAAGTTCAAAGGGC
ACTGCGCCCAGCATGATGCAATTCCATCAGACTCGTAGCCTATGGCGCAGGTCTCCGAAGACAGGTACGTCTTGCGGTAGCAGGCGGAATC