Description :
From Genome Similarity Track
Location :
Scaffold_679:542- 13301
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_679-fgenesh-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_679-snap-gene-0.7Fbxw11 protein
Pytiw_DAOMBR242034maker-piw_contig_679-snap-gene-0.5Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_679-snap-gene-0.6Brefeldin A-inhibited guanine nucleotide-exchange protein

Sequence
12759 bases(100 bases per row)
ATTGGGGTCTGTCTTCGAAAGGCTTCATGTCAGACAAAAAAAGTTAGCTACTCGCCCTTCTTATCGGCGTGCAGTGTACTTACCAGTACGACTTCCGACT
TCGATATCGCCAACATCAATGGTAGCTGCACCACGCTCCCGACAAAGACGCACGGCTTCCACCAAGTCCATTGAGCCACTGGTTCCAAAGTATACCGCCG
CGTAGTGGTTGCGCTCTCCGAGCGATGCTGGTGCGTAGCAATCGCAAACATTGCAGTGGCGCACGGCCAACGGCGGAAACCTCTCAGAGCATCCAACGAA
TTCCCCGAAGCCGAATGGAACCACACTCGACACACCATCTGCCGAGAGAGTCACAATCGGTCTTTCTAACAGATGCGCGATTGTCATCAATGGTAACTCG
CCACTGTTCTCCAGATGCTGGTTCGGCCTCGCTATGAGCTCCTCGATCTCACCATTGTTGCGACGCCCAACGTTCATAGCCTTACCAGAATCCAGAAGTG
TCTTCGCCGTTTCTGCTGCGAGCCATCGAAGGAAATATACGCTCTCCATAACATCAAGCCCAAACGGTTTCTGGATATCACCCATACGAGCAGACAGCCA
CACCGCGCGATACAAGCAATTTCCATCGCCGGTCACATTCACGACTTCAAACCAGATCCCCAAAGCAGTGCAACCGCTCCCTTGGCACACAACCTCTGTT
CACCGGTCAATAGCCGCAAGCCTTCAACCTCGTCAACTTCCCGCACCATCGTCGCTTTCAAAGTGTTCAAATCGATCTTGTTGTATAAACGCGTGCGAAA
CAAATCACATATTTCACGAGTATACACTGTTTTGATATTCCAACGGCGTCATGCCATCCACACCTCCCATACTTCAACAGTTGCATTATAACCACACAAA
GCTACTACACTCATTTCTTTACATTTGCTGTCCAATTTTCCCTCAATTGGTCACCCTAAGAAAAACTATTTTCCAAATATTAAAATATAGAAAAGGACTA
TTTAAAATACTCTCTTACAATACAGGAATTTTTTTAATCAAAAACGGAGCCTATCATTTGCCCGACTGTGGATATCGTACACGTTACTGACACTTTTTGT
AGAAATGTAAATCATTACAGACTTGCCATTTGTATATTGTAACCGGCTACCTTTCTTACACGGTTTTTCTTAATAATCCTTCTTGGGCTGTCGTATTCAC
TTCGTTCAACTACCAGAATAATGCCTTTTTTTACAAACTGGATACCGGTATTTGCACTGGTTTTTTTCAAAAGCAAATTCCCGCGCTTTGTTTTTCATCC
CTCATTTCTTGACAAAGTTGCACGAATGTTGGCCGGTCATTTCTTCAGAAAGTTGCACGAATGTGAGCTGAATGTTGCAAGATGACATATCAGACTGCTG
GTTTTCTCCATGTTGCAGAAATGTGCGCCGAATGTTGCAGGTGCGCGCGATCGGGGGGGGGCCATTAAACGAGAACTCGCTGGAGCCGCTCACAGTACTT
CTTCCTCGTCCAGGCAAGCAACTCAAGCAACTCAGCAGCAGCAGCAGAAATGGCGCGCGGCAAGGCGGATCGCGGGCTCACGGTGGGCAAAAAGCTCGAG
ATCATCGAGGAGGCCGACCGCACGGGGCTCATCGCCGTGACGGCGCAAAAGTACGGCGTGAAGACGGGCCAGATCCGCGACTGGAAGAAGAACATCGACC
GCCTGCGCGCGACAGACCCGAACCGCCTCGTGTGCGCGAGCACCATCCAGCGCGGCCACCTGGTCTTCAACGAGACGTACGCGCAGTACTGGGTCGGCTA
CAACAAGTACTGCTCCAACCACACGAGCTTCGATGAGGTCAAGGACGCGCTGCGCATGACCCAGAAGGACGTCGGCCGCGACGGCATCAGTGCGTATTTC
TGGCCAGGAGTTCTTCGTTTTTCACTTGTTCGCCCAGAGCTCTAACTCTTGTGTTTGTGTCCAATGTGCTGCAGACGCCTTTGGGTTCCCGTCGACCGTG
GACCCCACGTCGACGCACGCGCTCGAGTGCCCGACCACGAACGGCTACTACACGACACCGGAGGACACAGAGGCCTTCCAGAAGGACATGACAGTGCTGC
GGGAGCAGCTGCGCGAATTCTTCGAGAACAAGCCGTTCCCGACAAAGTTCATGTACTTTGTGACTAGATTAGATTTTTATAAGCCCGACCCGAGCGCCGA
CGCCGCCGAGGACGAGGAGGACGCACCGCCGAAGGAGAGCGGCGAGCCAGCGAACAAGGAGACGGACCTGGACAACTACGTGTCCATGTACGTCGCGATC
TGCGGCAACGGCTCGGTGATGGTGCCCATGGCGATCTTCCCACCGACCGAGGAGTGGCACTGGGAGCGCAAGAAGCCGGTCAAGCTGCGCCACGCGTACA
GCATGCATCGCACCAAGCGCAACGACGCGAACGAGGCGCTGCAGTTCTTCGCCGTGACATGGAAGAAGTTCTACGACGAAGAGGCCAAGTACAGCGACAA
GTTTGTGTTTTTGCTCGACCAGTCCCTCGAGGAGTTCCAGTCGCCCGAGTTCAACGATGGGCTCAAGCAGCTCGAGGGCCACGGCAAGTACTGGACGACG
TTCTTCACGGGGCGCAACCCACTGCGCCTCTCGCACTTTGACGATATTCTCTCGACGTTCGTGATCGAGGAGTGGCGGAAAATTCTGTCGCTCAAGAAGT
CGGCGCAGCCGAACGACTACCGTAAGTGCGTCGCCTTCTGGTTCTACACGGCCTGGGAGCTCTTCGCGGGCGACCACGCGCGCACGGCCTTCCGGAGCTG
CAACATGTTTCTCGAGGACAAGTCCGTCTGGTCCACCGAAGACGACAGCCGCAGCGCCGTCTAAGACACGAAGAATCCAGTCATCGAGCGCGGTTGACAG
CAGGCGTCTCGTGTTTTTAGTGCGTCGCAACTTGCTTTTCATTTTGTTCGCGTGATTTGCGCGGTGTAAGTAGCATGTTACATCATTTCGCTCCACGTCA
CTTGTTGGCATTGCCTTCTTCCTCGTCTTCCTCATCTTGGTCCTGAACCCCAGCAGCCTCATCATCCTCAATGGGCATGTCCGAGTCCGAGTCAGAACTC
TCGTCTTCTTCCTCCTCTCGCTCCCCTTTGGCTTTCAACTCGGTCGCATCATCAATTGGCGGGAAGTAATCCTTTGCGAGTAGTGCAAGCTTGCGCGACG
CCAACTGCGCCTCCACATTCATGCTCTTGGCCTTGTTCCCAGCCACAAAGGTCAGGTTCTCATGCGACGCCTTCCCGAAAATGGTCGAGATTGCCATGTC
GAGCGTCTTGAGCTCGTCTGCAGCCACGTTGTTGTTCGCATCGATGTCTACTATCAGCTTCTGGCCCAGGTACAACTTGCTCGAGTCTGGCAGCCCGTTC
CACTTGAGCAACTGGTTGATGCTCGTGCGATACTTGAGTGAGAGTGCCTTGAGCGTCTCGCCTGAGCTTAGAATGTGGCATTTCTTCCGGTCCGCTGCCG
AGTTGACACCAATACGACCCTGCCAGTACCACAAGCGCACTTTGCCATCCGCAGACATGCTCATGAGCCGCTTGCGGTCGAACTGTAGGTCCAATACGCT
GGTTGTGTGGCCGTGGAGTGTCTGGATGAGGCAGCCCGTGGCAAAGTCCGTCACGCAAATGTCACCGTCCTGAGCACCACTCACAATGCGCGTGGCATCG
AACTGAAGACACAGTATAGGCACATTTCGATGAACGTCACAAATCCGCAGCAACTTATTGTCTTTGCCGTCTTCACCAGCGTCGAGGTTCCAGATGATAA
TGCGACCGTTGCTGTCGCCGCTGACAATCTCGCTTGAGACCTGTTTCAGACATGTCACAGGGTACAAGTGACCGTTGAAATACTCGTCACCGCGCCGTTC
AGGCTCCAGACAGTACCGGAGTGTGGATTGCCGGTACACCACTGCTGGCGAAGAAGCTAGTCCGAGCTCCCAGACTTTGATGCGGTTGTCAGCGCCTCCA
GTGGTGAACCAGTTTCTTACACTATCCACCGCGATTGCCATGACGCTCCGGTCGTGCGCTGCGATCACGCGCGTGATGATCGCAAGAGAGCTTGCATCAA
ACACGAACACGTCGCAGTCCGAGCACCCGCAGACAATCAAGTGGTTGTCCGCGGCAACGCTGACTACTGCCGCGTCGAACTCTTGTATCATCTTGACGAG
CGTCACACAAACTGTCGAGCCACCACCGTCGTCCTGAACTTCCCAGACACCAAGCGCAGCGTCCATGCCACCAGTGTAAATACGGCTCCCAACGTAGTAC
AGCGCCACGATCTGCGTCTGATGACCTCGAGGCGGACCCAAATGCTGTCTGAGCGGATCACCCACCGCCTGACCCAGACACGCACCAGTGAGCAGATCAA
AGAGATGACCAGTGAGCTCTGATGTCGCAACGCAAGTGGTGACGCCGTGACTTGCAGTGCCGACGACGCACTTGAGCGATTCGTTCGTGGAGCTGAAACT
GAAGCAGCGCAACTTGTCTTTTCCTATCATCTGGCGCATGAGATTGCCCGTCTCGACACTCAGCTCCTGCTCCAGTTCGTGAATCTCGTCTTCGCTGTTG
CTGACGCGAATCTTTGCGTTTATGATCTCCTTTAAAATGCGCTCTTCACCGGCCATGACACTGCCCATGAGCTTCGCGAGCTTCTTCTTGAAATCTTCGA
TCTCGTATCTCGCGCCTGTGCCGCTCAGCACACTCGAGTCCACCTGCGACGTGTCGCTCGCGAGCGCGCGTTTCAGGTCAATCTCACCTTGCACGAGCTG
CATCTTCTTCTCCAAAAGAAGCTTCTCAAGACTTGAAACGAGTTTCTTCTCTTCGCTGATGTCGAACCTGCGCTGGATGCGCTGTGTGCGGAGCCGTGGG
ACAATGGCGCCGACACGTTCCAAGGTGATTTCGGTCGACGATTCTGCTCCGACACCAACGAGTCGCTTTTGAAGATCATCGAGCACTTGACCAGCATTTG
TAAGCTTATTGGAGAGTACAAACTCGATCTCGTCAGCTTGTTCCTTGTTCAAGTGCACCATTTCTTTGTCCTCGAGCTTCGCATACACGCATTGTAGACC
ACGGAAGCACGCCACTTGTCCCATCTTGTCCCCCACAGCTTCAAAGCAGAGCAACGCATGCTCGTAGCTCTCAATGCTGAGACGAAGCGACCGCAGCGTG
AATTGGACCTGGGCAATGAGCAGAAAGATTGCGCCTTCCTCTGCGCGTTGCCCGAGTCGCACAGATAGAAATGACGCGCGGTTCAGAAAAATGAGTGCTT
GCTCACTGTTTTTCAGGTAGAAACTCACTTTCCCAAGCTTGAGCTGCAGTTGCAGGATCTCAGTGTGAGGCATCTTGTCCATCCAACTTGCATTGTTGAG
GATGAAGCGGTACAATCGGAAGGCGCCTGCGTAGTCGTCAATGTCCATCTTCGCGTCAGCTTCGAGCATGAAAGGATAGTACTTCTCACGCTCGAAAATC
TGCTTTCCGCCGTCAGTCGCTTTGCCAGATGTCAGATGCTGCTGCTCATTCTGCTGCTCTTTCGTCCAGACCAAGCTCTTGAGATTCCCATCCGTCGTGC
GTAGCTGCTGGAGCAACTCTTGACTCTGAAGCATCAGATCATCACGGTCTAGCGTAGCATTCACGAGTCCAATGCTTCCAATGCCAAACACGCCGTCGGT
GGCACCACCATGTCCACTGCCGACCTGACGCAGGACATTCCGCACGATCCACAGCCAATGCTGGAACGCAACTCGGCAGCGGTAGTTCAGAAAGCGCGTC
AACGTCGTCCGCACTTTGCTCCGCTGTTCGATCGCAGCCGTGCGATTCTCCACGAACGCTGTGAAAGCGCGATATAGCACGCCTTTGCGAATCCGTGCGA
GGCTCGCCATCTTGACGTCTTCTTGGCGGTGGCTGCTGCGATTAGCATCGTCGGGGCTTCCGCGAGGGTTCAACTCAAACAAAGCCAGGGTGTCTTTGCG
ATTCTGTAGCCTTTCCAGGATTACATCACGCTTCTTTATATCACCGCGAAGGTAGTTCTCGACCTTGATGATCTCGCTCTTCGCGTCGACAATGTAGAGC
TGTTCGATGCCGATTTCGTCCTCGAGTGCAAAGATCAGGTCTTTCGTGTAGAACCGCTGGAGTCCATTCTCCAGCACATCCGAGTCCATCTGCGGGCCAG
TGAACATCTTTGCGCGCTCGAGCTCTGCCTGCTTCTCGAGAATCCGGTTTTCGGCCGCTCGAATCAGCGCCACGAGGTCCACCCGACGGTCTTTGCTCCA
CTGGACGTTGTATTCTGCACTCTTGAGTCTGGCATTCAGGTCAGATAAACGGAAATGGAACTGGCGCCGGCGCTCTCGAATTTGCTCTTCCTCGGAGAGT
TCGTCGAATCGTTTCCGTGGCGTTCCTGATAGCAATCGTCCATGCACGCCATCCTCTGCCAAATTTTCACCACCTTCGTTTTTGTCCGATAAGCTCATGT
CCGTTCGACTCAGGATGTTGTTGACTTTTGCTTCCATCGCGGGATGCATCGAGACGATGAAGCGCGACACCTGGAGGATGTAGTGGTTTCGCTCGTAGCG
CTGCATGAACCCACTGAGAAATTGTGAGTCGACGATTTTCGTTCGAGAGTTGACTGCAGCCTGGAGTTCATCAAGCAGCTTGAACTCGTTCCCTGGAGCG
ATTGTGAAGATCGACGCGACTGCATCGCTAAATTCACCGGGTATACCCGCGCGATTCACTGCGCGCACGTGAAAATCCTTGTGCTCTTTCCCGCTGAGCA
ACTCGGTGATCATGAACGTGGAGGCACTCGACGCTGTTCGCACACGGCGTGGCTTGTAAACCACCTCGGACACGTCGAGAAAGTTCTTCTTGTCGGTTGT
CGTATCGGCGACGGTCTCCTGCATGATAGCTTCGCTAAAGACGATCTCGTAGAACTCGATTGCAGCGCCTCCGTCGTCCAGCGGCTCGAGCCAGCCAAGA
GAGATGGTGCTCGCTGTAATTGCGCCTGCACACAGGAAATAGGGTTTCGTGGGTGGCACGGTGGTCGCAGTCTTCACAAGCTCGACTCTGTTGCTCAGTT
TGCTCTTGCCGTTCTTCGTGATGGCGCAGATCGCAAAGTTGCCGTATTCCTGGTCTGCGACGAGATCACGCATCCAGTACTCTTTTTGAGCCACAGGCTC
TTGAAGACACCACCGCGAAGTTGTTTGCGGCGGAAGCGCATGGAACTCGCGGACTATTGCTGTGCGCTGGATGCCGCCGTCCTTCAGTTGCTTAGTCACC
TTCTGGCATAGCGAGAAGTGCACTTCGTAGTCTATGATCGGCGTGGAGCCTGTGAAAATCGGTGGATCCCACTGCAACAGGATAGCGCTGTGCGTAACAC
TTACATCGCTATCGATATTGACGCGCAGATTACGCGGCGGCTGCGACACGAAGCGCGGGAGTTTTAGAGTCAGGGAGGGAGTAGTAGAGTTGAGAGTGCT
TTCTTTGACTTCATTGATCTGGTCAGCGAGCTGGTTCACGTTCCTCACAGGCTCGAGGGGGGAAAGCGCTGTTGCAGCAATCTGTTTGTTGTTGCTATTG
GTGGTGCAGCTGGCTTCATGAACTGCAAGCACGTGTGGCAGGAGCTCCTTCGCGCAAACTCTGCACTTCTTCATGCAGCTGCCATGCTTCCTGATCTCAT
CCAGCTGCACCAGCTTGTTCTTTGCAAAGTTCTTCTCGCCAGAGGAGTCATGAAGCGTCTTGGAGAGTCGCAGCACACGGCTTTGGAGTACATCGAGGTC
GTCTTTCTTGTGGCGGATCGACAGCTGCGCGGCAGTGATGCCCGTCTTGAGTTGCCGCATATTCCTCTCGACCTGGAACTGCTGGTCGCACACGCGCAGC
GACGCCGCCTGCTTCGCCTGCATATCGACCACGCTCAAGTGCGCGTCGAGGATTTCCTGTCGCGTGTTCCATATCTGCGGCAGCAATGCTGCAGTCGATG
TCAGCACTTGCGTTGATTCATCCGTAAAGCGATTTTGTGGTGTGCTCTGCGGCTCTTTGGATCGCGGAGGCGAGGAAGAGCTGGGAATCGAGATGGAAAG
CGGCGTTTCCAGACACAATGACAGTAGTGACGACGTCGACGATGACAGCGCTGCTGCAGATAGGAACGCAGGCAGAGCTGGAGCGGACGAAGCGTTCCAG
GGACTGTTTTGTAAGAGCGACTGTGCTGCGAGGCGGCGGTTCTCGACACGCCGCTTGAGCTCACTGGCGCGCCACTCGGCCAACCCAGCACTCGCAGTCG
CAGTCGACGCTTCGTTCTTCATGTCCACTCGCACCTCACGCGCCTGCGCACATACACATGACGACACTCTTCATCAGCAGCATTCGTCTTGGCGCATTTG
TTATCCGACACCCGCATCAAGACTGCCCTTCGTACAACTTGCTCTTCATGCAACCTTCGTACAACCTCTACTTCAACTTGCAAGTGAAACGACACCCGCA
CTCTCGAAAAAGAAATAGAGAAAGCAGCATGCGCTTCATATGGAGCGACGCGTGGGCGTAAGCGAAACGGAAGGCCGCTTTCTCTATTGATACAGAGCGG
AAGGAGAAGCTCTTCGGTTGTACGTGCGGTTCACACTGGGACTGGGCGGCGTTTGGTGAATTGAGAGAGACAGCGAGAAGGCCACTGCACTGCGTGCGTT
CGCTGGCTAAAGTCACAATGAGTGCGGCTGCCACCACCGCGCGATCCGCGGGCGCGCGTCGCAGAAGCAAGAGCAGGATGAAGCTCGAGATGGAGGAGCT
GCCGGAGGTCGAGCTCAACGGGACGAGCGCTTCGTCAATGGGTGCATCAGAGCAGTGCACGAGCAGCAGCAATAACACGGACGTAGTGCTGGAAATGCCC
GGACCCGAGTGGAAGCACGAGCCCGTGATGCGAAACGCGATCCACACGCTACTGCAGGAGACGAGTCACGACGAAGAGCAATTCGCGTTTCTGCGCGAAG
TGTGCCAGGAAACCCTCGCGCGAAAGCACCGCGCGTCGATGAGAGGATCGGCAGAGTCGTTGCGTTCACCCTCAACAGGTGGCAACAACGCTACGCGGAA
AGGCACCATGGAGTCGAGCACCATGTCTGAAGGTGATGAGATCACGCATGCAGGTAAGACTTTGCTTGCGCCGAAGAGCCCCCAGGAGCGTCTCATGGCG
CTTGTGCCGAATGCGATTGAGAAGAGCAAGCGCAGCTACCAGCGCAGAGCAAGTCCCAGGTACGACGCTACAATGTTATTATTCGCTGCTGTGAATCTGT
TAACAAGTCGACGCTGATGTCCTCCCTTGTAGCACGAGCGTGGAGGAGTTGCCGCGCTGGAGAAACTCTGGTGCTGACGAAGATCCAATCACGGATCTGA
TTGTCATCTTCACTGGCGACGCTCTACCTGACGGCTTCACTAAGGTACAGTTTTTGCTAGCCTGCTCTGTGTTGCTGTCGCATATTATCACGCATAATAC
CAATAGAACGTCAATTCCCACGCAGCTCGAGCGTTCTCCTAGCGGATTTCGAGCTGACTTGAACAAGGGCGGACGAGGCGTGTTCGTGTATCTCTGTCAG
CGTAAAGACCAATCCGCAAACAAGCTACCCATCAGCGAAATTATCGCTATCTTTCCGGAGAGGGGTGAATTCGTCCCGACAGACTATGAAATTGTCCAGC
GACGAGGAACTCCAGCCAATCTTAACACGGTGAGTCCACGCTCTGCTGTCAGCCAAAAATGTCACCTTGCGATCCCCATAAGATGAGTTACCGTCCTTTT
CCTTTTCTCTGCAGGGAACGCAAGGCGAAAAGATCTTCTTGTGCTTCAAGCGCTCCGTGACATCCTCGATCGTCGACTTACTGGTGCTTTTCCCTAAAAA
GGGCGATAAGCTTCCATACGAGTGAGTGATCTTGCCACCATTGCTTCGTCTCGCGCGAATTGTCGAGAAGGAGAGCTCACATCATGTTTCTGACTATGCA
GCTACATGAAAGTGGACAAAACCCCCGATGGTCATCTCGCAGACCTCAACATGCATTCTGGAGGCACTGAAGTCTGCCTCTGCTACAAGAAGAAGGTTTG
TTGATCCCAGATTTCTGAGTAAAGCATGCATATCGGATGCCATTGTCAAGATCTCAAGTAACAGTTTGATTGTATTGCTGCACAGCTCACCTCCATCTCC
GAGCTGCACTCGAAATGGCTCCACTCCACTCTCAGTGCTTACGAGGACGAGGTTCGCAGTGCTTCGTCTCCGCCTGGACAACCGAAGCGAAATACAAAAG
GCTCTCAAAATACGCCACGGTCGAAACCTCCACGTGGCGCACCAAAGTCGGCTGAAAAGTCCTCGGAGGTGCGTGAAACAGGACTGACGAGTCCGATTTC
CGACGAGTCGTTTTTATCTGCTCCGAAAGGTACGAGTGCGTATACGTCTTGTGATACAAGCATTCTCCACACTGATATGTCTGTTGCGTTAGGTGAACAG
CTCTTCAGCTGGAAAGAAGCACAGGAGTATTACCTGTATCCACTGTTGCTGGCGTGTTACACTCGCCATGGAGATGCGGCTGAAGCCGCGTTACAAGGCC
TGTCGCAGTGCCTGGATGCGGGAGTGTTTGATGATGCAGCTGCGATCTCAGATGCATGCCGCTTAGAGGTAGCTGTTGATGCGGTTACTTCGGTTTGCCA
CCAAGGCGTGAAGTCACGGTTTGCACTGGCACTGCCATTTTTCAGAAAGGTAAGCCGGCGACATTTTGACTACATCATACTACACAGTGGAATAGTATCC
TGTACTGACAAAGTGTGCTCTTGCTTTTCAGGTGATTCGGAAGTGTGCGAGTGGATTCAGCTCGGCTGTTCTGCATGCCATTTTGAAATCTGTCATCTTC
ATCGGTGACTTCGACTCGGCGTTGGTGAAATCCGTGGAAGATGAGCTTGTGACAAAGATCATGAGTCGGTATGAGGCTGAGCTCTGTGACAAAACGAGCA
GAACACTTGTTGAAGGTACTCACGCGACAACGGCACCATGGTCGACTGATGCCACCGCCCGAGATTTTGTCGTGCATCTCATCGACGATGTCAGTTCGGG
CGTTGATCTCGCGAAAAGCACCGAAAAGATGCTTGGAGTCTTCAAGGTCAGTTCAGTGTCACGACTTCTCTCAACTGAGTGCCCGACTTCATACTCACCC
AAGTTGTCGCGTTTCACAGAGTCACTCATCCATTCACTCGCCGACATTTTGTACGGATCTGACATCGGCAATGAGCGACTTCATCGAAACTAGCGTGAGA
TTCGCTCTTCAGTCACAGGCATCCTTGTCTTTTGTTCAACTCTAACTGTTTGTTTACCCCTCTGTACTTGTAGGTTGAAAGAAACGCGCTTCAGCTCGTG
ATCACTCTAAGCAAGGCAGTGCACCGAAAAGCCACGAGTGCCAGCGAGCAAAGTCCCGCCAGTGACTACGTGTCGATCGTCAACTCTCTTCGAGGACTAA
ACGTTGCACTGTTGGCTACTGGACCATACACCAAGGAGTATCGCGTCTTCGGCCAAATCATCCGGCGCTTCGTATTTGCAACACTCAACTCGATCATCCT
CATATGGTCGACGGATGTGTTTCGCACGAGTTTGACCCTGACGTCGACGTTGTGGAACCACTATCGACGGCACCTGAAAGTGGAGTTGGCGTTGCTGTTC
GAGCATCTCTTCCTGCGGATCCTTCGCAGCAACGCGGAGTGTGCAGTGAGTCACCAGATGGACATCATGCATGAGCTGACACCGTGGGTCCAGCTGCCAC
ACAATGTCGTGGAGATCTTCGTCAACTTCGACATGGATCGCGTTCAGCAATGGAAGATCTTCGAGTTCTTCTGCTCAGCACTTTGCAGTATCGCTGAAAG
CAACACGTACCACGAAGACCCAGACGGCTCGACGCTGAGCTTGAGAGAGCAAGCGATCAACACGATGTTGGCGATTGCTCGAAGCGTCATGGATGCGAGT
GGTCACGCCCATCTGATCAGTCGAGACCCTCGCACACGCCACCTCTCTATGGACAATGGTGGTTGGGAGCAAGATGAAGCTGGCGACGACTTGCTTGGCG
CGAGTGTACCAGCTACACAGGCAGGTCGCATTGAATCAAGCAGCCCGCTGACTCAACCCAGATCACCAACGATCTGCAGTCCAAAAGGATTTCCTGAAAA
TCAGACCAAGCCCGGCAGCACAGGGGCTCCGAAATTTGGAAGCATGTCAGTGCGCATGCGCAATGAGCTCCAGAAACGCAACCAGCAGCTTTTGAAGCGC
GCAATGGAGATCGCGTCGGCGAAGAGTCTCAAGAAAGCAATCGAGTTTCTTGTTGCGATGAGTTTCGTCAAGGAATCGCCGCGTGATGTCACGTCATTTC
TGCGAATTTATCACGATTTTTTCGATGAGACTGAGATCGGAGACTATTTAGGTGAAGGTGATGAAGACTTCAAGGTTCAAGTGCGGCTTTCGTACGTGCG
AGCGATCTCGTTCAAGGGCATGACACTCGTCGAGTCGCTCCGCCACTTCCTCACGAACGGAGGCTTTCGACTCCCAGGTGAAGCGCAGAAAATCGAGCGA
ATGGTCGAGGCGTTTGCGCAGTGTTACTGGGAAGACTCACCAGCTTCTTTCTCTTCAGCAGACACAGCCATGATCATTGCGTACTCGATCATCATGCTCA
ACACGGATCTGCACAACCCTCAGGTGAAGAAGAACAAGATGTCGAAGGAGCAGTTTGTG