Description :
From Genome Similarity Track
Location :
Scaffold_1834:542- 1596
Transcript NameFunction/comments

Sequence
1054 bases(100 bases per row)
GTGCTAGAGCAGAAGGGCCCGCATTGTCGACACTGGTTGCGCTCCTTGTGGCTGAGTGCTCCAGACCGAGGAGGGCTGGAACTCGAGGATGCTGACGGTA
GTTCACGTTGAAGAGTGTGAGACCAGTTGAAGCGTTGACAGCGTTGTTCACTGAAAATTCCACCATTGGGAAGAACGTCCTACATGACTTGAACGTCGTG
GCGAAGCTTCGGAGCACATCGTCCATGACCCTGTTGATACGCTCAGTCTGACCATCCTTCTCTGAATGTGACGCGGTGGACATGTCTAACTGCGTCCCGA
GTGACTTGAAGAGCGTTGGCCAAAATACTGCAGTGAAGCAAGAATCTCGATCAGACACGGTCGTGGTCGGTAAGCCATGATGGCGGTAGACCGTGTCAAT
GAAAATCGCTGCCGTTTGGGCTACCGTGACGGTAACAGCTACTGGAGCAAGACGGGTCATCTTGTTTAACCGATCAACGACGACCAGGAGACCCGTAAGC
CCTTGGCTGCCTCGAGGAAGGCCAAAACCAAAGTCCATGCTCAACGATTGCCAAGCATCACTCAGAATTGGTAGTGGATGTAGCGGAGCTTGGCGCGAGG
AAGCCGGCTTGACGCGTTCACACGCTTCACAGGATCGCACCCACTTCCGGACCCACTTGTGCATGTGGGCTCAATCAAAGCCGCGAGAGAGCAGAAGTAA
AAGTCTTCTCGCGACTGAGGTGTCCGCCGCATGGAACTCGTGACTTAGGCGAGCTCGAAGGTCGTCGCCCAACTGTACGACGATGCGCGGAGGATCCTCG
CGGTCGATGCAGTAAGTCAACAGGGATCCATCCGGCGCGTATCGATCGATAAGTGCGCGGCTACGCGGAGACAGTAGACATCGTGCCGCGTCGGACAGGG
CTCACAGGTATTTGATCATCTCGGAGCATGTCGCGTCCGACTCGTACGCGGATATAATCACGTCAGGGAGCGGACTAGTCGCTGCGACCTCGACGGCAGC
GAACTCGTCAGATACACACACGGCACATTCATCGTCATCCTCGTCGCCAACCGC