Description :
From Genome Similarity Track
Location :
Scaffold_299:5419- 25016
Transcript NameFunction/comments
Phyta_totarag6811hypothetical protein PHYSODRAFT_248130
Phyta_totarag6812hypothetical protein
Phyta_totarag6813hypothetical protein PHYSODRAFT_335022
Phyta_totarag6814hypothetical protein PHYSODRAFT_469333
Phyta_totarag6815hypothetical protein

Sequence
19597 bases(100 bases per row)
TCAGATGCTTGCCTTCAACCAGGCCTTGGGCAATGAGCCAGCGGTAATATCGATGTGCTCACCTTGCATGACAGAGCCGCAGCAAGCGTGACGTTGAGGA
CTTCTTCTCCTCACTGTGGGGAGCAGAcgctgaggaagaaggcgccgaTATTGGACGAAAATGAGTACGTGTACAGTACTGTGAGATGGAGCACGGCACC
CCATTGGCTGATTCCCGCAGGACCGTTACGGTTACGCCGGGGCTGTGCTATGTTCTGTTCACACACATAATCAGCGCTAGACGACGAAAGGAGCCCGAAG
CAGAGTGCACGAGCCTCGCTAATGGCGTCTCGGTCGCTGCCCCCGGGGCACCCCAGCAACGTCACTCGCTCCCCAGTCCGACAGAATGTGACGCTACGCT
GGCTCAACAacgctgcgccagctccagcaacttccaAGACCGCGCGCTCCCCTGTGAAGAGATGGCCACCTCCAAAGGTTGAAGCCTCGCCCCATGTTCC
TACGATCTCAGCGCCATCATCGCCAGCGGCGTCGGAGCCTgttgtggagaagaagaataCGGCTGTGTCTGCATTTCAGTCTGCGCGGGCCATGTTTGAA
GCTAAAAAATcctctgcagctgctgtcaccccgccaccgccgccgacCCGTCGCCGATTGACGTTCCCTGTtccgccagcgcctgctATCGTGAAGCAGC
ACTCTGCATCGTCGGATTTgtcgagctcttcctgcagcacgGTTGACGCCGAAAGTGACCGGAAGCTGGAAGAGAACGTGAGAGCTGAAGACGAGACGAA
GCCCTGGTTACCAGCTCGTGTGATGAAAAAGGTGGAAAAGGAGTCAGTCGTGGCTATTCCTTCGAAATTAGGTGCTGCGAAGGTATTGCCCTGCCCAAGC
GAGCCCGCGGCATATTCACCAGCTCGAAAATCCCAAGCACCGCGGCCTCGTGACCTTCCAGTGATTGTGATAACGCTAGAGCAAGAAAAACTGGAGGGGC
AGATGCAGGCTGAAATCGACCCGTtccgacttcttcttcccgtCGAAGCTGTTCCTACTCTTCCTAATGAGGTAATCTGCGTTTACGACAGTGCCGCCAT
CaaaatggagaagaacatcaagaaggtggtgcggaagctgctcaagaaaaaCAAAGTGCGATTAGATGAATTCAAGGTTAACTCGCGGCTGTTTGGAACC
GATTTCATGGATGCGCATGCTTACCTGGACATGCTCATCAAGGACTTTGGACCTATTCGCGCATTGCAACTGGTACCGTGCTTGCTGAGCATTCAACCGA
ACATGGTCAAGAGCAATGCTCTACTCCTCACAGCCAAAAACTACTTGCTGCAAAATGAGGAGGCTTTGGAACGCGAGTTCCAGAATTTTCACGTATCCAA
TCCGAAAGACATCAAGACTGCTGCTAACACAACGTATGGGTCACCGGTAACTCAAACTATTGGATCTGTTGCAGTGAGTGCTTCTCTTGCTGAATCATCG
GGGAAAACGCCTTCCATGGTCACTCTGAAGGCGGCCCCTACGATAAAAACAGCGGTGGCCCCCACAGATGACGCAGCTCAAATCGCCTCGAATGACCCCG
CTCCCAGTattgttgacgttgctgccagcaagCGTAGTTCTCCATTCGTTCAGCCTCGTGTTCCTGGAGTTTTGCCAGCCCCAGTTACTGTCTTGGTGCA
AAAGCAATTAACCAATATCTCCACAGAAGAGGTGGTAATGACCACGAGCAAAGAAATCAAGCCGGTAGAGCCAATGCCAGAGCCCCAAGAGGCGGCACAA
ACCggagcgccgccaccactgATAAATATTGCAGTGAGTGCTACGAGCCcgacagcagtgacagctCGAACAGCGCATGTTATCTCGCGCAATCCTGTTG
TGAAGAAGTGCGCGGAATCTGATACCCCAagcgacagcgaagaagaattCCGTGTTGACAACTTATTCGAGGAGACGATCAATCCTCcccagaaacagca
gcaaaaacagcaaaaacagcaaaacaatTTGGTCATGTCTGTTGCTCCACCCTCCCCAACGTCTTCGACGCATAGCTTCGACGAAGCGGAAAGTTTGTTT
GGAGAACGGCTGTCCGTCTCGTCTCTTTCAAGTGTGGGCCGACGAAAGACTGTGACGTGGGGAGAGACACAAACAGTGGTGGCCCCCGCCGAGCAGGCCG
CTCCACTCAAGACGATGAAAAAGCCTGTGCCGCTCATCTTCGGCCCCGCCACTGCAGCCGCGTtcgactcggactcggactcggacgaggCAGACTTTAG
CGATTGATGTTTCCTGAGAGGTTGTCATGCGTGAAGTGGAACCTGCATCTCAGTCGAGAATCGAGAATATAAACTATCCATACCGTTGTAATGATCTTGT
GCCTTGGCTTGAGACTCTCACAAGTTGAGAGATGGTGGTCAAGGCATACCGTTGTAATGATCGTGTGTGTTGGCCTGAGATATGGTGGTCAAGGCTACTG
CATACTGCATCTTTGCGTTATAATATGACGTAACATAGTCTATTTATGCCTTTCAACAGTCCGTAAACGATTTCTTCACAATCGCCACACCTCGACATGT
CGTCGCCCCAACttcagccgctgcagcggccGAGCAGCGGCGCGAGCTTGCAAGGCGACTTCCGCGTGGAAGTAATGGGCAGCCAGGAGTCTCTAGACCT
GGACTGTGGCAAGTTCTACACGGTTAGTGAACAGCATTGATAGCTGTAGCCTCTGTCTCTCTGACGCTCACGTTGTTCGCCTACAGGAATACATTctgcg
ctgctcgtggaTTGAACGCAATGCAACACCAGAGGTTTGAATGCAGGCAGCTTAAAGTCCATAATATTCAAGTTATGCAGTTCAAATTGATTGATACGAC
GCAGATTTGGGACGTCGTGCGTCGCTATCGCGAGTTCTGCGCAATCGACATATTGGTAAAcccgagaagctgctggcctGTACATTTCAACGCTCCAAGT
GGCATACATGACAATGAGCTAACGTACGCAAATGTCTGTTTTGAATatgaagctgcgcgagaagtATCCGTCGCGTGCGCCAATGTTCCCGTACCTGCCT
AGCAAGAAGTACATCGGCTCGTCACTGTCAGCCGACTTCGTGGACAAGCGGCAGCGCGACCTCGGTTACTACATGATGTCTATTCTGCACAGCTGCCCAC
TGGTACGGGTGGAGTGCTACATCCTTTATCACTCTATCATCTACTACTTCACTAACTCAACAACTTTGCTGTtggcagctcgtgcaagACGAGATCATCG
ACTCGTTCCTGGACATCAAGCGGCACATTCTGGAACGGGCGCGCGAGGAAAACAGTGAGCGGCGCTCAGCCTCCACCCCTACGcacacgacgagcagcaa
cggcgGCAGTAGTCCCATGCGACTGCAGCTCTAATCATTGAATGACGCACGCACCCTCCCCAGTCTCTTTGTTGACTTCAATCTCAAAATAGCGCTCAGT
CCAGTCTATTCCCAGTTTCGCCGAGAGAAGGAAACCGGTGCACTTCACCATACAAATTTCCATATAACCCTCCAAATCCTCTGTAATCCGATCATGACAA
TCACTCTGCGCGAAGATTTCGTGGCTGCACGCGAACACAGGGAGCTCCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTCGGGGGCGTTCGTTACC
AGAGCAGGCGGGTGCAAGGCGACACCAGACATATCTGCAGGCGCTTCCAGTCTCCGCAGGCCCCAGACACCAGACCACGAAGAGACCACCGTCCAAGGGG
GAGAAAGAGAGGGAGAAGATGGCGCTCGCGGACATCATGTCGGTGGAGATGAGCGCCAAATACAtggactcgagcagctcgtccagtcTGTCGTCGGAAT
CGGATgacgtgtcgtcgtcctcgagctcgtcggtgatttcttcgtcctcttcggcGTCGGAGTCGGAGTCGGACACCCCGCGCGCTTCTGTGAGGAAGAA
AACGGATCCTCGAGGACGTGCAGGCAAGCAAGGGGGCGCTGGACTGTCGGACTacgaggacgactcggacttGGACAGTGCTACCAGtgggaggaggagg
aagaagaggaagaaagtCACGAAacctgcagcgccgagaAGGTCTCCTACGAAGAGCAACGGGAAGGCGAAGAAAGGGGAGAAAGCTGCATCTGTGGCAG
CACCGCCGACCCTcccaccgcctcctcctccaccgtcgccaccTCCTGCGGCCAAGGATGGAAACTCGTCCAGTAACAGCTCGTTCAGTGACAGTTCTAG
CTCAGACTCGTCGGACTTATCAGACTCGGAGACGCCGTTGGCGCCCCCACCACCTCCTCTGGCTAGTAATGATGCAATTGCCGCTACTACTGCTTCTGTG
ACCACGGCTACTACTAGGCCGCCAAAGCGGAGAGCtgcaacgaagaagaaagtgacTGGAGCGAGTCCATCGTCATTGAAGGTTACTCTGAAGCTCCCAC
CAGGGTTTATTGCAAAGAATAGTGGCGCAGCGGTACTAAACTCGTCCACGCCTGCTAGTAATCGAGCGAAACTTAACTTTCAAGCGACAGATCCAGCGAA
AAGGGCGCGAACATCGAGTAACACAGCTACCGGTAGGAAATCAACACTCACCACAGGTTCGAGATctacgaagaagaaccagcCTGCAGGTCGAGCACAA
CCTGCTGTCGGTGGCCAGGGTGCTGTACCGGTAGTCCAAATGAATGGGGCGCTGCCCACGGCAACGCTCGCTCCGAGTGGCCCTCCTATTTTACCAAAAT
TGATTCCAACGGGACCTACTGTCCCTGCAGAGGAAGTTCGGGGTGCAAAAGAACTGTCACTCGTGGACCATGCCCACGTTGGAGATAATCCCAAAGAAAC
CATCGAGTCAAACATTCCGACACATTTCAACGACCCATACGCTCAAGGAGGTGATATACTGCGTCTTTTGGACATGTTCTTCTTTTGCGACGAGAATGGG
TACGTCAACTCGTCGTTTTTCCTTTATGGGGAATAACTCTTACTGACGCTTTTTTTTATGATTGCAGCAAAGCAATCAGTCTCGAGATTTTAGACCGACC
TAAAGACCAGCGTCCGAAAATCATGGGCTTTGGTACAGTTGTAGAGCACTTACCACTGGCAGAGCGTCCACTCCCGATAAAGCCCATTCTCGCGTCCCCA
GCATTTCCTTCACGCTCCAAGAAACGCCCTCGCGCGgactcttcttcatcaacccCTGCGAAGTCTCCAGCCTCAAAGTCAAGAGCGCGACCCAAAGGTA
GATTACTAAGCACCACCACTTGCTCGCTATTTTGTTTCCTGTTCTAACCTGTATTGCTTGtcacgctccagcagctggtcaTAACAATGGTAGCAAACGT
GCGAAGGTGGATAATGAAAGTATTTATCAAGGTGACGGTGAgtttgaagaagaggagaacgAGCCCTCTCAAATGGGAGAGCGTGGTATTTTTCATCGGT
CGAATGTGTACCGTTTTCCCAGCCCGTTTTGCCCGAGTCAACTGTCTCAAATGGATGGACAATCTGGTTCAGATAGTGGAGGCAGCGACCTGACCTcgga
tgatgaagatatTCGTTCTGGCCGAAGTGGATCTGGTGCAGGTTCAGACAATGATAGTGAACTCCTCTCCTCGGCCACCAGTAGCTCAAGTGGCAGTGAA
AGTGATAATGACATGGATTCTGGaaattcttcttcttctggaagaaACGGTGCAGAAAGCGGTGCAGGAATGACTTCCACGAGTCGGCACTCATCAACGA
CGAGACCGGCGACAGTTCCAGCTGAACACTTATCTCAAAGAGCTGCAGAATCCAAAAAACCTGCAGTCGACAGAGTGCAAAGGCGACCGAGTACCCGAGT
TGATTCGAGAAACGCTGGTTTGCCTTCTGATGTTGTCGAACTTATGCGAACCGACCAAGCTGTTGAAGTAAACGCGAAGGGCACTCCTGACGAGCTTAAC
TTGATGGAGTGCGGATTCCGTCATCCTGCTGGCTACGCACGTGCTCGTGTTTGGCTTCCTGAAATTACGGATTGGTGCCTCGACTACGCGGAGGGAGACC
CTACATTGTGGGTTGTCACGCCTCATGCCTGGTACAAGATCGCAGGACCATTATCGGGGCTGTTGCCACATTCGTCATATCGTCAGATTTTCAAGCACGT
ACGCCATCTATTTGAGGCCAGTTACCTTGTGGCGTACGTTCTCAAAGAGTGGCTGCCAATTAACAAAAAGGTGTCCTATCGGGCCACTCTTCAGCAGATT
ATTGAGCTATCTCTAAACGGCAGATATCGAGTGGTACGGTTGCTGTGCTATGGCGTCTATGTTGGTGGCATGAGGGTCTTGACTTACTATCTAACATTAA
TGCCGGTGAATAATATGTGTCTTTGCAGTCTGCCTGGTTTCTTGTGAAGAACTACCCGTTCATCCGGGCCCAGGTTTCTAACCTGTTCCCGGATAAAGAT
ACGTATCTGGAGTCAATGTTCTTTAAGCAATTGTATCGCTTGCACGAAAATCACACGTTACGTGTAGCGAGGCATCAAAAGGAAATGGCCGAGCGGGAAG
TTCGACGCACAAAGCGAGAAAACGAGCGTCTTCAAAAGAAGCAACGAGTTGAGGATGAGCGACAACGTTTGAAAGATGAGCGTGACGAAGAGCGAAAGCA
GAAAGAGCAAGAGCATAAATACCCTGTGGAAGATGTGCGACTTCTGGAAGGAGAGGCGGTTAGCACTAACAGCCTACCCTTGAGTTGCTCAAGTTTGAAG
GGCGTCGAAGGCCCACTGCTTGGTGAGCTCATCATGGCGTGGCAAACGATCTGCACGTTCAAGGATTTTGTGGGTCTTGAGTCTATCTCGTTGGAGGCTC
TCGTGGAGTGTATCACGACTCGCTGTGACGAAGGAACCCATGTTGGCTTGGCCCGGATCTTCATGGCGTTCCTACGGGTCATTTTATCGGAAAAGTCATT
TATGTCACAGCTGGATGATCTCGTTGTTGAAGGTAACATCAAGGTATCGGATCTGTTTGTGAACAGTGAAAGAACCTATGGAACTTGCGAAGGTACGTAT
GGTGACATGTTAAATGCAGTCACTTGGCAAGAAATTCTCCGCCAACTGATGTCTAAGGATCTGGGAATCGACCCGTCCATCGGCCACGTGGAGCCTTTAG
TGGGTTGTGAGATCGTCCGGCAAACACTGTACATGCAAAACAACTCGACCCCCTTCAATGCTCCAGTTGACATGACTGTAAAGGGTCTGGAAGATTACTC
GCTGATTATCAAGAACCCCATTGATCTGGGCActatcaagaagaagatcgatTCGGGAGGCTACGAGGGACCTGGTGGGTACGAAAAGTTCGCGGAGGAT
ATTCGTTTGGTGTGGGAAAATGCTGTACTTTACAATGGCGAGGAATCGGAAGTGGGTCGCGCTGCGTTAGCGTTGTCGGATGTGTTCGAGCAAGACTACG
AGAGATTTGTGGTTGGGCGCGTTCGTGCGAATCAAAGGCGGATTGAAGGGTGCGAGAAAGCAAAAGAAACTCTTAAAGATCTGTCCGCTGAGGAGATCAA
GTCATTCCAATACTCGGATGTTGTGTATGGGTTGTACTGCTCGGATTTCCACAACCTGCCGACAGCGTACAAAATTGGTGCGCTTTCGTGGATTTGTTCA
GAATTCTTAACGCTGTCTAGCATTCGGACCTACATGGCATCCCAGGTGGAGCAGGAAATGTTGATATACCGGAACCATAGGAAGCGCGCAGCCGATTTAG
ATTCACGGAGAAAACACTCGGACAGAATGCGACGCGAAAGGGAGAACGCCTTCAGAAGAGATTGTGCCAACCAAGGTATCCATCCTAATTCACACAACGT
TTTCTCGGAGGGCATTAAGCGCCGGCACGAGTTCATCGGCAAGTTTTTCGAGGACATACAGGCtgagaagatcgaggacgAGAAAAACTTGGAGCAAGAG
AAAAAGGTTCAGGCGGAGGAAATGGCGAGCGAGTTGAGCTCGCTTGTTATTCGTGAGTCTCCTTTGGGAAAAGACAGGTACCACAATGCCTACTATATGT
TCAAGCATGATACGAAGCCGCGGTTGTTCATCGAACGTGGTGACTCTGGAGATTTTGTGGTCTGCAGCGGTAAAACCCAGCTTATGGAAATTTTGGAGTG
GTTGAATCCGAAGGGAGTTCGGGAGCTGGACTTGTtaacgaagctgcaggaggtgaAAGACAAACTGATTAGTGCcttcgaggaggagcaaGATGGAGAT
ACCACGACGGAGATCGTGTGGAATACTAAGGGTGGCATTGAGCTTCAAATGTTTCCTCTTCCTGGTGGCGCTATTGAAAGTGAAATTATGACTATCACGG
ATGCAGACAGGGTCATCAAGTTACACAATATCGCCTGCAGGATGCTGCTCTGCCTGAAGCAACACCTAGCAAATACGAACACGCTGCCTGCTTCGTGGGA
AGGTGCACAGACATGGAACACTCGTGTGGAAGTGGCAAAATCATTTAAAGAGCAACTTGATTTGTTTGCTGAATTGGAAAATGCCGCGGTGGCAGCTTTA
AATTCGGGTGTGGAGACAATCCGACCTTCATGGCAGCGGAAGCGGCATGAGTGGCGATTGGCTCTGGAGGGTTCTTGTACGTACGCACAGTTAGTGTTTT
TGCTTCACTTGCTGTTGGAAGAATTTATCAACGTGGAAGCTTTCATGGATCTGCACATCCGTTTGGATAGACGGGAATGGCTCAAGTTGCGACCTAAGGA
GACTCGGAACTTTATTCCTGAGGCCGGAAAGGTTGTTGTATACTTCGGGGATGGTCATGCTCTAGCGCTGAAAGAAGACGAGAAGTCCAAGAGAAAGCGC
TTCACACAGAAGAGCGATACTCCTGTTCGTAATGCAACAGTAATCTGCACGGTGGAGAAGGTATCTTATCACCACGGTGGAGGTGACCCGTATGCATTGG
CGGTGTTACAACCAATTTCCGATATGGCACAACACGAATGCGTTCGTAGGCCAGGCACACTTCTGTGCCCCTTGCCATCGCGAGAGCAGAGACTAGCTAG
AGTCTTCTTGCGAGTTCTGGCTAAGTTGAAGATGCTTGCCGATTCCGGACCGTTCATGGAGCCTGTGTCAGATCGGGAGTTTCCGCAGTACAAGGAGATT
ATCTTGCATCCGATGGACCTCGGAAAAATGTCCAAGAAGGCCAGCGAGCTAGAATACAACAATGCGACCGAGTTTATGACCGATCTGAGGCTCGTACGCG
ACAATTGCCAGCTCTTTTGCGAAGGCCGCTTTCCAACACTGCCGCCATTGGCCCACAACTTGGTAAACGTCGCGGATGGACAAATCAAGAAGTGGGGTAA
AGAAATTCGTGCATGCGAAGTAATCTCGGACGAGTCGTCACCTGTGAAGAAAAGCAGCACGCCATCCCCCGAGAAGAAGGGCGTGTCGAAGCAAGACGAG
TCGGAATCTGAAAATTCGGAGTTGCCAACGCGTTCAATTGTGACCATCTTGCGGCTCGAAAACCGATTGCCAGAGTACATTGTGGATGTCAGCCGATACT
CGTGGGCAGTGAACCGTACGTGGCAGTGTGGAGAAAAATTCCGTATGCTGTTCCGCAACCCGCAGGGCCAGCCAGGCGAGTACTACGGAGGCGTGACCGC
AGGATCCTTGCCGTTCGACAAGCATGGTATGCTGCCATGGGAGCCGCTACGCATTACGTgggacgaagatgacggatCGGACGACAATCGCATTAACCCG
TGGTACGTGATTGACTTGAGGCATTTGAAGTGACGAAGGGATAGTTTCTCACTCCTTTTTTGTTGTAAACAGGGAATCGGAATTTCCTCGAGGTGGAAAT
CGGGCGTAGATAGAGATAGATGTTCCAGACCCGCGCACATGCCACCAAAGGTGTTCACATGCCAACATACCTCAGCGATCCAGTGTGTGTATGATCGCTG
GCGAAATGAATACGATGGTTGAGCCGGTTGCTGCCCGGTTTCTCACTTTACTTTTTGGTTGTTGTGCTTCACTTGTCCCCACTGTTGTCGTACAGATATT
CTCAATTTGGAATGAAACGAATCATCGCTTGATGTTGCACAACGATTCCCCGTTTTTGCATAAATAAGGCTCGATCGACTGTAGAGACCACCAGTATGGA
GAGGGGCAGACGAGGTACGAGGCTTCCCTGCCTCTTATTTCCTCATATTCCCCCAGAAGGATGTGGGGCCTTGCGCAGCACTCATCATGCCAGCAAAGCG
TTGGGCTTGCTGGAACTGCAATGGTTGCGGCGTTGCTCGGTTGGAAGGCACTTGCGTACGCCCTGCGTACTCCTGAACAGAAGGCTGCAGATGAGAGCTT
TCGGCGGATTCACCGACCCGAATCCACTTTGCCTGTACTGGGTAACATGCTGGACGCCATGTTCTTCCAGATCGAGTGTTTTGTGGATTGGATGGCTGAC
CAGAGTGCGCTTGCAGACGGAAAACCGTGGCTCATGAGCATCATCGGACAGCCTCCAATTTTCGTGGTCTCGTCCCCTGAGAGCTACGAAGACTTGTTCA
AGACCCAACCACATATCTTCGAGCGTGGCGCCACCATGTCGTACATTTTCAAGGATTTCTTGGGAGAAGGCATCATCGCTGTCGACGGGCACAAGTGAAG
CCAGCAACGCAAAACCGCAAGCCACTAGTTCACAAACCGGATGATGCGCGAggtgatggaggaggaggtgcatGACAAGTGCGTTAAGCTTCGTGGGCTT
CTGGATCGCTGCACAGAAGAGGGAAAGACTGTGAGCATGAAGTCTCTCATCTCTAAGTTCACAAGCGATGTGTTCACGAAAATCGGCTTTGGAGTGGGGC
TGCATGGGCTGGATGCTAGCAAGCTGGACTTGGAACAGGAACATCCATTTATCCAAGCCATCGACGATATgtcgcgtctgctgcagcttcgttgccAGCA
ACCGATGTTCCTGTGGCAAATGAAGCGTTGGCTTAACCTTGCTGAGGAGCGTGAGAACAAGAAGAATATGTCCATTATTACTGCCATCGTCAATGACGTC
ATGATGCAGTCTCTTTCCCAAAAATAAGTTGTAACAACGGACGCAGATGGTGAAAAAGCGTTGTGCTGGAGGACCCGACGACTAAAAAAAGGActtgttc
tccttcttcatggaATCTGGGCTAACGGATgccaagcagctgcaagatATGGCCGTCAATTTCTTTTTTTGCGGGCAAGGACACCTCGTCTTTCGTGTTA
TCATGGTTCGTGGTTATGATGAACCGCTACCCCGACGTTTTGCGCAAGATTCGCGAAGAAATTCGTGAACAGCTTCCCGAATTGCTCTCCGGTGAGATCG
ATGCACCGTCGATGGAGCAGTTGGGTCGGCTGCAGTACCTTGAAGCCGCTATCCGCGAGAACTTGCGCCTGAACACCAGCATGACCACGCGTTCGCCTAA
CCAAGACACGACTCTTAACTGCGGGACCTTCATCCCAAAGAACTCGATGTTCTACGTGTGTCACTACGCCTCAGCTAAAGACTACTTggggagaagatgc
tgcagagtACAAACCCGAGCGCTGGATCGACCCGGAAACAGAAAAATTACGCCAATTCTCGCCTTTCAAGTTTGTCACGTTCCTTGCGGGGCCACGCCAA
TGTATCGGCATGCGTTTTGCCATGCTAGAGCTCCGCATGATAGCTGCTGTGCTCTTCAgtcgcttcaacatcaagACCATCGAGGATCCGTTTGATTTAA
CGTACGAACTTTCGACAGTCTTCCCTGTCAAGGGCCAATTGATGTGCACGGTTGAACGAGTGACCCCGGATTATTCAGCTGCATCAAGCTAGAAGATAAG
CTCACGACGATGGCATCCTGCGTCTGTTGTGTCGATACGCCGAGAAGACACAATGCATTATTCATCGGTTCATGTTGCAAAATGATAACATAGCCATTCG
TTTTCTGTCACATCGCACCGCCGGATTCCTGTGACGGAGTGCATCCGTTTGCACGAATGAACCTTATTGCTGTTACTgcacaactgcagctgctcgtttC
CTCCTATCCGCTAATGTGGCGCTACACCACCATTATCTCTACCTAACTTACCTGCCTCTGCGTATTCCTGAGAAAACGGAAAGGGAGCGGACCTCTATTT
CTTGTTCTGTTTCTTTttgcttttcttcttcttcttgggtgTACTTGCTCCGTTGGGCGTACCAGACTTCGAGCCTATTGACCCGTTTGCAGCTAGCTCT
GCCTCCTCGGCCGCTATCaaagccgccgccgcagcgtCCTCTGGCTTACTGGTGAATTCATCATCGGTGCTATCTGCCTCGTCCGCATCGTGGGTACCGT
TGCTGTTCGGGTGGTGCGAATTCCTCTTgccttttttcttcttcttgcgcttcttaTTGCTATCCACTGCATCATCCTCCGGCCATGCGACGTCATCCAC
GAAACCTAATGAGCGCGCAAACTCAGATCCGTGGTCAATTCCAGCCTCCTGCTCTTCGGTCAACATCTGCCACGAGTCCTTCTGATAGCCAGGGCGAATG
GCCTGAGGAACCATAAATCCTAGGCCGTTCACGCAAAGTAAACTGGTTTGATCGCGTAGCTCCTGCTCAAATCCACGCCATGTCGTGTGCGACTGTAAGA
AGTTGCGCAAGAACGCCTCAGGCGACTGCGAAGCTGCTTGCAGGCGAATAGCGTTGCAAATTTGCAGAATGTAACCCTTGTTGCTAGTAGAGTCGCCGTC
TGCATGGTAGTGCTCCACCAACAACGTGATCAACTTAAGCTTCTTCACAAGCACCTCTAGTGCCTGCTGGTTGTCCGTACGCAGTGCAATAAACACAAGC
TGATAGAAAGCTGCATGGTACAGATTATTGTGAGAATACTCAAAAAACCACGTAACCAGCACTCGCCAGACGTTCGCATCGAAGTGTTCGCTCATCAAGC
GCGGGTTGTGCGCCATGACCTCCACAAGTGCCTCGACCAGCGTGAGTCGCAGTTCAGTGAAAGGGACCTTCACCACGTAAGCCGTGTGACGAACCGCACC
CTCCGGCAGCGGCTTTCCAGACTCTTCATCCGGCATCTCAATATTCTGCTGACGCACATATTTCTGAATGAGGTATTTCAAAAGCTCGCCAAGGTGGAGC
TCGACAAGCTCGTAAATTTTCTCACGCAGCGGCCTCAACTGGTTGGGCACGAGGTTCACGATCGTAGCACCAAAAGACTGGTACGGACTCGTCGGCGGAC
CTTGCACTTTTTCCAACGTactcttctgcagcagccggaACACGCACTTCATCGCAGCAGTGCGTTGCCCCACCGTCCTCTgcgtcttgctcttgctgtc
cTCCGGCTCTACCGCCGCACGAATCAATCcctccagcaactccggGCAGTACGCGGCcggctgcaacagcaactgTCCATTCTCATCGGTCGCAAGGCGG
TCCAACAGCTCCACGAAGACGTCCGCAGCTCCAATGGTATGGGTCTCTCCGTACTCGGTACTGCACACATGGTTCgccaagaccagcagcaccttccaCT
CGGCCAAGGCTCGGAAGAACGCCCACTTCTTCGGGGGTGTCGACGCGTAAAACCTcatgacagcagcactgtGAGGCTTGCACACCAGCGTCAAGAACAG
CTCAGCCACGGGGGCATGCTCCAGATACGGCAGCATGGCGCCCATGTACCTGGCCACGGTCGTGGCATCTTTGCCCAGCACGTCGTacacgtcgtccagg
taGAAGCGGAGCAGGTGGTCAATGACTCGACAGGCGTGACGAAGGTTGCCCTTGGCGTCGCGCTGGAACACGGGGAACAGACAgcgcgtcagcagcttgc
tcttgtcCCCGAGGAACGTGAGCAGCGCCTCGGCCGTGTCGTCGttcgtcagcagcatcgtggcGTGATaggacgccagcagctcgggtGTCACATTGTC
CTGCGTCTCGTCTTCGCGGCGGTTGGCTATGTCTTCGGCAGTCGCGAGTTTGTCGGCGTCGGGGCCGTCCGGGAGCGTCTGGGAGGCGTCGGAGTCCACG
CGCGCGatgaagttggtgaagtGCGCGAGTGTCGCATCGTTGCTCAACGCGGAGACGAGCGGAGCGGTCACCGCCGGGTTTTCCTCGTCCAGGACactgc
gcagcagctcgtcgggGGAGGACGTGGCGGACGCTGCCGAGTCGCGGCGAGACACCGTCACTTCGATCATTGCTATAGAACAATAGCGTCCGTCGGGGGG
TTATGGCGACAGTAGTGGATGGTTCGTAGGGACGACAAAAGAGCTGTTGGGGAAAAGTAGTGTAGAATTTGTACACACTGGTGGAACAGAATGGTGTAGA
ATTGGTGTATAATGTAGGGTTAGAAACATTCCCTACCCTGCCGTCATAAggtcagcttcgtcgtcttcaacttgttcttcttgctgcgtCGATGCCTTCA
TAGTGTGGagatgttgttgttgatgtcgtTGGAAATCCTGGAGTTTTGCCATGGCTTGAGCGTAGAATGGATATGTGGATGCTGGCTTCGAGTGGATTGG
GAGTTTCTGCAGGACGAGCGCGTAGTGGCAGCCGCGAGCGAACGGTGTCCAAACGCGGAACCGGTCGGGCGATATGGCATTGGCCACATCGAAGATGGCA
GGCCACAGCCGATGTGTCGAGTCCGTGGAGATGAAGTAGCTGCCGGCGCTGCACTGCGAGAAGAGCGACTGCAGGAACGCGTACGCGCTGTCACGCAGCA
GACAGAAGTTCTCCACGCACACGAACGAGAACACGTGCAGTTGGGTGGCTTGGAGTGACCGGCGCACGTGGTCGTTCTCCTCGGCATGCACGTCAAGCGT
AATGTCGCAGTGCTGGAAGCTCAACGAGGCGTTATGTTGGCCGAGTTGGTCCAGCGTCTGCCCTACTGCATTAATCGCACACTTCCAGCCCGGCTCGTTG
TCGTACACAGTGGTGTGAAACTTCACGTCCCAAGCTCGAAAGTATTCCCGCATGAAGACGAGTCCAAGTGCATCGTACCCTGGGCCTCCACCATACAACG
CCATGTTCCAACACTCCGACTGCTTGGTTCTAAACAATTCAGATCGCAACCCACTGAGCTCTTcagtcagcagcaggttcgGTAGGTTCCCGCAGCGgtt
gatcttctgctggatgTAGCCGCTCCGAGCGTGCGTGTTCTCGAACGAAGGTCGCTGTCCAGTGTTCGTGGACAAACAAAGACCTTTCTTGAGCTCCATG
GTCTCCGCTACTGCAACAGCAGGCAACAGCTCCAGTAGACGCGGCAGGAACGAATGGCATTCGTTGCGGATGAACGTGGTCCAGGCGTGTCGGAATGCAC
GACTGCGGAGACTCCACACCGATTTTCTAGGCTGCacgccagcttcgccaccTCCATCGAATTGAAGCCAAGTGCAAGTGAAAAGCCATCGTCTACTCAC
TGCACGGATCTCGCGGCGCTCTCGCAATGACAGAAATGACGCCACCAATGCGCCGCACTCGCCGTCCATTGCTGCACAACCCGAAAATAACAGCCATTGC
ACTAATTTCGGCAAAAATATGTGACGTGTGAAATATGTAGCCATCTATCTATTGAGCCCTCCGCAAGGAGCTTCGTACTCGCTCTCGGAACTGCAGTAGA
TGGAATGATTAGATTGGATACAATGGAGAGAAAATGATCTTGAGGCTGCACTACCCACCGTGCGGTTCATCCCGTACGCGACAGCATTCATCGCTCCCTA
AGTTAGCAAGACAACAAAAGGGTGAGACTGTCACAGCACACTCGATGACACATGAAGAGTTTTCTGACGTGTACCTGCAACGGggtgaagaagctgacca
aATACAGGAGCGGAGCGTCGAGTACATGATTCGGAGCCACTGCCTGGTATGCAAACGCGAAGACGATCCACACGTTCGGAAGGAAGAATGCCCAACTGTA
GAGTAGAAGTCGATAGTGGATTCGCGTCTCCATGTTTGTCGACAAGCTGTCTGTCTTCTTAGCAAATAATACGAAGTAGTGAGTCAGAGTGTAGGCACAA
CCGCAATATGAAACGCGACATGGGAGTTATTATACTCACCATTAAATACAGCAACATCACGTACGTCACAAGGTTGTGCAAGAAGGTGAGCACCACGGGA
GTGTAGAAAACAATAAGCTGAACGTAGAACCCTTGTTCGCTCCACTGATCGTCACTCCATGAGCGTATCCAACACCAAGGTCGCCCACTTTCGCCTACCA
GATCTGTTCCGGCCCAATACTGCGCGTACAAGTGGGTCACAGTCTATTCAACATGGATCAGTCGTGAGTCTCAATAAAACCACCGACGTGTCTAAAACTA
CACAAACATCTCACCGCAATAGGTATCCCCCACGCTACAAGGTGATACCTGTCCTCGTATCGTTCTGGCGATTTACTCCGTCGTGTCAATAGCTGAAAAA
GGTGGAACGCAAAGCACGCAGTCCAAAAGCACGATGCTAGCTGGAAGAACACCAGTGAATAACCCTACAGATCAAAACCAGCATACAAGGAAATAATGAG
CAAGCGGGTAAGTAGTCCTGCCCCCGTATACTACAGACCTGAGCAACGCATATTCTCGTTGTTTCAATTCCAACCGGATCTGCGTCTTTATCGCGCGCTG
GCAGCAGAAACACCAAAAGCCAAGCACAGGCAGCACCTGCATCTGCTAGATgcaagcagagcagcagtcgtcgtccacatctTCGTGACTCTGGAAAGAC
CAGGAAGTGCACGATCATCACCAGTGCTCCGAGAAGCGACAACCCACTCGAGACACCGACCAGAAGTTTTGACGTCGAGAGCTCGCGCGCtacatgaagc
tgctcgtcctgcagTGATGCGCCCGCATTGCTCATATTCTACAGTCCAACACGAGTGACTTGCATTCTACCAAATCGGATCCGTCGGAAGATATTTGATC
GTGCGGTCACCatcgcttcaacatgaacgATAATGACCCTTcaggacaagaagatcgcAATGCAATCGTGTATGTGGATGGGCTTCCATCCTAATGCATT
ACTTGTTAGTTGTTAGCTGTGTCTAATCTGGTGTGAAGGTGATTCCGCCGTCCTTCTGGCGCTTGCCACACAAGCATCCGAATAATTTGACGCAAGGCAA
ATCGTAGTAGTACTTCTCCTCCGGGTCACTCAGCACGTGATAAGcttccttgagcttctcgtaCTTGTACGGCTCGGTCTCATTGTTGAAGCGCTTCACC
AACGTGTTGTAGGCTGCATCGATCTGCTCACGGCTTGCAGTCTTTATCAGTCCGAGTTTTGCATACATGTCTTTGGCTTTCCACATGCGGATCTCGTAGA
attcaagctgctgacgcagcGCCTCTAGTATGCGTGCTTCACACGCACCCCAGTCGTACATGTGCCGCTCACAAAAGTTGTGCGCGAGAATCTCTACGTA
GTGAACGCAACGTTGGCCACCGTGAGGTTCTGTCTCGCAGATCCAGTCGGACTCGGGGCGCACGTACTCAAGAGTGTGTGATAAGCCAGAGTACGTGGCT
TGGACGGAAAACAACGTACGTCGTGGCTGCATGCGGTTGCAATCGACTCGAGTACTATTGCACACGATCTCCAGCAATGTCGTGTTTAGAGGTGCAGTCT
GGAACAGATCGTGCTTCTCCAGAAATGCGTACACGACGTCAACCGGTTCTTGACCCTCCAAGATTTTCACATCTCCGAGCTTTGTGCTAGCCGACTCCCA
GACTGGGATATTAATCAGCATTGGTTCAGCGCGCGTGCAGTTTGGACGCTTGCGCGGTTCGTTGCACACTTCGATGAGGAACTTCTGTCGTTGCCGTAGC
GTCAAGTTACGCATCAAACCATACTCGTAGATCACGTCGGTGGAATCCTGTCCGTCGTAAAATGGTAATCGTTCTCGGCCACCATCGGGAAGAGTGTAGA
CAGCTTCGTAGAGAATCCCGACTTCTCGTGTACACTCGAGTCCACTTGCGTTGCACACACCGGTAACAATTCTATTCTTTTCTTCCGGCCCCAACTCGTG
CTTGTTTCCGAATCTAGCAACGGCATCTGCCGGCTCTTCATTTGCAAATACCTCTAAAATACCAAGTTGGGACCCGTTCTGAGCTGACACAGGCACTCGG
AACACGACAGGGGCGTAACGCGAACAAGTAAtttcgtcctcatcgtcttcttcctcatcagGCTTCGACTTTGAAGAATCGCACAAACTGTCTAGCAATA
CCTCGCGGTCTCCCGGAGCTAGATTGTGCTGCTCAGCAAATTGATAAACCACATCCACAGGCTCCTGTCCTTCGTAAATGTTCACGTAGCCCAATATCTG
GCCACTGCTGTCACTCACTGGCGTAGACCGTAGAAGTGCTTGACCTCGAGTGCACAGAATCCCCTCCCGTGTCCCACAAAGTGCTTGTAGCAACGAAATC
TGCAAGTCTCGAGTGATATTCGTCTGTCTTGAAAACCTGCGCACAGCATCGGCTagctcttcatcctctcGAATGGACAAAACACCCGCTATTGTATTAT
TTCCCACATCAATAGGAGAAGAGAAGACTATCGGCTTGAGGCGCTTGCAAGTCACGTACTTGTCATCACACACCTTCCTCACCAGATTCTGTCGGAATAG
TTTCGCCAATCCGTAGTGCAGTCCGAAGTTGTGTACTACATCTGCCGGCTCTTCCCCTAATGATATTCGTAAGGTTCCAAGCTGACGAGGCTCGCCAGTC
TCCGCATCTCTCGCTACGATACGCTGCGAATACACCAAGGGAACTCTTCGCAGACATTGGGTGTCGCCAACAGCTGAACACGTCACATCCAGCAACTGTT
CCATCGCGAACATCGGCAACGTGTGGTCCTTCACGAACTTGTAGATTTGATCCACTGGTTCGACGTCGTCATAGATTTCTAGCTTACCGATTAGTGTGCC
TCCGTCTCCTGCGACAGTCTTCGAATGCATTAGAGCGTTGTACCTTGTGCACGCCACATGAGGCACCGCACACACAGCATTCAATATCGCCACTCTTCCT
TCTCGCCCGATGTCATGCTGCAACGCAAAGCCAAGCACTGCGTCCGCTGGCTCGATGCCTTCCAGTATCTGGAGTTCTCCCAGCATCCCGCCACCTGGAC
CTGTGATCTGCGTCGAATAAATCAACGGAACTTCGCGACGACAAACCACACGAGGTTGCtggcagatttgcaccagCATATCGTATCTCCACGTGGTCGT
CTGGCGGTGACGCACTCGAAAAGCTTCCAACGTGTCCACCGGTTCCTGACCCGAGAGTAACAGGAACTGTTTGTGCTCAGGCGGGGGCTCCAGAGGCAAT
TGGACCTCGAGTAAGACTTCCAACGCCATGCAAGAGACTATGCAAAGCAAGAGGAAGGTCAGCCATGATATAATGAGAGGTGGGGAAGGCATTATGGAGC
GAGCATCATAGTGGGGTGGCATCGTAGAAGCTCAATTGTGTCCCTTCGTTTGGATACGCGCAACTTTAGGCGCAACATAAGGTCAAATGGCTACGTT