Description :
From Genome Similarity Track
Location :
Scaffold_1:5416425- 5423637
Transcript NameFunction/comments
Physo_473291Hypothetical protein

Sequence
7212 bases(100 bases per row)
AATGCTTCTGCGGCTGCTGTGGTGTCTACTCTGTTTCTGCGCGCTCGCGATTGAGCTTGCAGACGGCAGCACACCAGCCTTATCGCGGGCAGGCTGCGTC
TGCCAGTCCACCGTGTTGCCATCGACGGGTTCGGTTGTTACTTGCTACCAGGCGGACTCCAGCTCCCCCTTTGGGTGTGCAGTGGACCCTTCCGACCCCT
GCGCGGACGGCGTCCTGGACCGAACGTGGGATCTGTGCAATGGTGCGTTTTTGCTTGATTAGCGCTCTTATCCTCTCACTTGTGATCGGTTCTAATGTGC
CAATGTGTATGCGGATCAATACGTACTAGTCGTCAACTTGTACCTCGTGACAGATCGAGCCTCATCTACAATTTCCAGTGGCTCGCTCAATGTCACGTTG
CATGGCAAAGAGCAAGTGACGTTGAAGCAAGCTCAAGTGTCGGATGATATTCTTCAGCGCAAGATCTCCAGAGTCACATTGGCGTTGGATAACGATACTG
CAATCGAATCCATTAAGGTAAGATTTGGATTTCTTTTCTTTTGCTTGTGGTGTGGCAGTTCAGTAATGCTCATACGATACGCAGGTCGAAGCTGCGGCGA
GCACGTCGCTCCGGATCTTTGAAGTACAAGCCACGCTAAACGATCTACCCACCACGATATTTTCTCCTCCATCACCTGGAACGATTTCTTTCGTCAGCAG
TGGGGAGACAGCGAGTAATGGGGTCGTGTCGCTACTGTTTGTGCCGGTGACGGAGTACTTTGACAGTCAGTGATGAAATTTTGTCGAGAGTATGAGCTCT
GTTCCTAACGCCATCATGTTGTGTATGTGCGTATGTTTGCTAGGTGACGTCCTCAGCCAGTGCTACTTTGATTTGGTGGGGCGTTGCGGATATCACGCTG
ATCTACAGGAGAGCTCGGACCTGCTCTTTCTGGCAGAAGACGGCAATGAGCCGATTGTGGCGGCCAAGTCAGCTGCATCACAATCTTTATCTGAAGAGGA
GAAGCCTCAAGCACCAGCTTCCCGCTCCATTTCCTTTCTGCCGAAGGTGAACGATCGTCGGCGGACAACTAGGTCTCGGTCAGTCCGCGCACAAGAAGAG
CGCGAATTACCAAGCGGAATAATGGAGGTTGCTATGGCAAATGAGCCTATCGATATTCGATTAACTGACGTACTGGGAGAAATAAGGCTGACACGATCCG
AAAATGCGCGATTGGACTTAGTATCAGTGGAAGCAATATGGCACGCCTCGAGCGCGGTTAAGAAGGCAAGCATTCGCGGTCTTTCATCAAAGACAACTGT
GATGGATGGAAAAATTGTGACTCGTTGGCGCTTAGTGCGTCAAAGCTCCGTCGTGAAGGTCTACCCGAACGTTGAGTTCTCCAACGAGACCAGCTTTGTG
CTTGTGATTCAAGTTCGAGCAGCAAGAAAAGTGGTCCAGTACTCCAAAGAATATTTCGTGGAAGTGGATCCTCAGTTGGATTTTCAACCGATGGATCAGC
CAGAACGATTTCTAGTTGAAAGCAGCGCAGAAGAAGATGCGGCGACGATACTCCGGCGATTGAACACAGGTGATTCGACCAGCCAGGATGCTGTCACGTT
GGAGTTGCTGCCTGTGGTCGTTGATCTAGAAGAAGGCACCCCGCTCCGTCTTTCGATGTCAGAGCTTTTTTCAAGTGACACGGCTACAAGCTCTGCAACC
TGCAAAACAACCTTTATGGTTTTCCACGTGGACAACGTCATTAGCTCCGTGAAAGCTCCGTCATTAGGCCTCCAGGATGTATCCGGCATCCACGATCCGA
CAATTGTTCATTCCTGCTCCGAAATTCTCTTGGTGTGGCTCCAGCCAAATGCCTCGAGTATTCAGGCCCAGTTACGGGTAGAGCTGACAAGCTCAAAGAA
TGCAGTGCTTCGACTCGCCACTATACCTCTCAAATGGACCGTGATCCCCAGTATCAATCTGCCAGTCGCGAGCCGTCTACTTGCTGGAGCCCACAACACA
CTGGCTGGTGATATTAAGGAGCTGACACTGAATTACTCAGACGTCCCCGCTGCTGTCCGCGTGGACATCACGGTAGACAATTGCACCTTCTTGACTATCG
AAACGACTGGGGATGCGAAATCGACGAGCGACGAGTGTACATTCCTCTTGAAAGCCTCTAATGAAAGCAGCATCGAAGATGTGCCGAGTGGAATAACGAT
TCGCCGGCAGCAAACGGAAGCCTTTCGAGTTCCGATTGAAGTGACGGCGTCCATGTTTGAACAAGGTGATGGCGGGACGAGTTGGGTACTCAGCTATTCC
AACGTGGCTTCGTATACTATCCACTTTTGCGAGCTGTACAGTTCTTCCAATGTTGGAGCTCAAATCTTGCGTAAGGGAGAGACTAGAAAGTTTCTTTTTA
CTGAGTTTGCACTCTCAGCTCTTGGCACAAGTCTATCCGCATCTCAGTTTACGGCGAATGTCTATTTCGTTGGAGATCCTGACTTCTTCACAAACGTGGG
TAATTTCCAGGTTGGTGGCGAAATGGTTCACTCGGAAGCGTACAATTTGTCCGCATCCTTCGTCACGTTAAGATCTGAAAGTGCAGACTCATTCACGGTC
ACGCCGTTGCAGTATGGAACCTTTCTGGTCGATATGATATTGGAGTGGAAAGACGACGCCAACTCCGATTCAGGCTGCTTCTTCGTACAAAATATGGCGA
TGTCAGTTCTCCCGTCGTTCTCTCAGCCACTTTTTGCCACTCCGTATTCGTTTAGCCGGAGAGTACTTCAAGGCAGCTCTGCACAAGTCACAATCCCGCT
CATCGAAGCGACAAGTCCTGAGCTGGAGTATTTGACTCTCGCTCTAAAAGTGAACACGACGGACGATGCTATCGCAATTAAACGCGGTGACACCCAGTAC
AACGCCTCTTCTAGCGACCCAAACTCCTACTTCCTGGTTGAACGGGATGCAGAGCTGGATTCTGCGAGGCATATTGTCATATCTGCTACGCCTAGCGATA
CCTTTGCTGGGATTTTGCGTTTTGATTTTGGAGTCTCGGCGGTTGGACTTGTTAATAACGAGATTCCCTTTGAAGGTCTAGATGTCGAACTATCGACACT
CCGTGATGTTGAGGTTGAATGGATCCCGAAAGCCACCATAGACCTACCAACCCCTTCAGGCGAAGCCGTCTATCGAAGTCTGCCAACGCAATTACAAGGC
AACTCTAGGTTGTCGTTCAAGTACCAGATGGGCTCAGGTAAGAGTATAATAATGATGCACACACTTCTTGGATTGGACCAAACTCCACTAACAGAAGTTT
GTGTGATATTTGCTAGACTTTTCGAGTATTTCCACTGACGTGGTTTTGAACTCGAGCGAAACCAGATCGGTGTGGTCGAGTGATTCAGCTGTGATTGTCC
AAGGCCAATGGAACTATGTCGAAGCGCTGATAGACCTATCGCATCCATCAACCGCTGAAATTGTTTTCCGTGGTATTGCATCGGTTGAAGACACACTGCG
GCTGAAAGAGATTGTTGTTCGCGACTTCGTCCACGAAACGATTGTAGGAGAAATCGACTTTGTTCGCGCTACTGGAGGCATGATTTACATTGAAGTCAAC
ACAGCGAAATCGATCCCGGAGCCAGTGCAACTTCGTGCCTACGTGAGTCGCTTGAACACCAGTAACACCCCAGCGCTCAGCTTTACGGGTAAGGATTTCG
TTGTGCCTATTCTGACACGATATCAAGATCCCTAACACTTTTATTGTAATCCTATAGGTAACGATCTCCAGTATGTTGGATGTGAGGCTACTACTAATAT
GTATCCGTGTGCTGATGACTCCGGAATATCCTTTAAGAGTCCAACCCAATGCAGAACGTTGTGTTCGTCAGTAGAGACCCAGCTGAAGTTCACCCCCGAG
TCTGTAGTGCGAAGTGCACAAATGGTGTCTTTCGCTGTCACCGATTCCTTTACGGTCGAGTTTTGGGTGTTTCTCGAGAGTTTTAGCACAAGCTCCAGTG
ATGAGCAACTTTTGTTGCTTTTTGGTACTCAGGAAGGGAGTCTGAGTATCACTCTGAGCAACTCTATAACGATCTCGCGCTGTGAAAATCATCTTCGGAT
CCCTCACGGAATTCCTCTGCACAAGTGGACTCATGTTGCGATTGTATTTGGTCCAGACGACGATATCACACTGTTACTGAATGGAGACCCAGTCGCGGAT
GGTATTCTGAGTAAGGTGAATTGCAATGTGCCGACCTTTGCCTATCTCCAAGTTGGACGAGGTACATGGACCATCAACACATACACAAATGCTGTCATTT
CTAATGCCTTTGTGTTTGCGTGGACAGACACTATGGGTATTCTCCCGGACACCTCCGTTCTACTAGGCGCCATGGATGAGGTACCATTCGTACATGCTTT
ATTTTGCATTCATCCTTTTGCAAAAAGGCTGACTTATTCCTTTTTTCAAATTAGATTCGTATTTGGAAGCTTGCGCGTGACCCAGCAGATATACTTGCTA
CGTTCCGAACGAATGTCGTAGATGATACCGACTTGATCCTACTTCTACCGTTTAACTCGGCAGAGAACACAAACTGGTTTCCTTCGGTGGCGGATGGAAG
TATACGCAGCGTTGATTTTATGGTGCAGGGAGTGAATGTTACCAGGACTCGCCCGATCCAAGCGTTTGGTGTCGCTGGAAACGGAAGCTGCTACTACAAG
TTGGCTGCGTCTGCTGACAAGTTATCGCCTACTACCTGTGACAAAACGTGCGGGGATAGAAGTTTGAGAACATGTGGATCCAACGCCAGTAATGATGTGG
CAAGTGTCTACGCTAGAGGCCCCATTGGAGTTGGAGGCCTCTCTCCGCTCACTGAATACGAAATATCAGTGGAGTTTGTGACGGCAGATAGTAGTGAGTA
CGAGATCACCAAGGCACTTATTGCTAACACCTCATACGCAACGGAGCCCGGAAAAGTGGAGTATATCAGCGTCGTGGAGCAGTATGGCGACTTGGTGGAG
ATTCAGTGGAGTCCAGTGGACGACGACGGAGGGTCGGAGATTTTGAGCTACTTGGTTTTTCTGAACGGAGTACAGGCTGCCGATACTGGTGCAGGGAGCG
TGTTATCAATGACGCTACAGATCCCGGAGACGGGACCAAACACCATATCGATGCAAGCACTCAATGCTATTGGAATAGGCCCAATGAGTAATGCACTTCC
GTTGACAGGTGTGTACAGTACTCCAGCCCCTGAGGTACCACAGAGTCCACTTGTACTATCTGTATCGGGTGGAACGGTGACACTCGCACTGGACCCAATG
GTGATCACGGCAATTGAAACACTTTCATCGCAAGTACTCATCCAACAGCAGGAACTTTCGGTCGCAACCTTTTTGGAGGCATTTTATCGACTGAACGGCT
CATCAGCCGTCATTTACAAGCTACGGCACAACACTGTTTACATCTTTCGAGCAAGCGTTATCAGCAAAAATGGCGCTCAAAGTGCATTCAGCATCCCGGT
TTCGGCTAGAACCGGCGACAGAGGAAGTCCAAGCAAGACGCCGCAACCAGTGGTGGCTGATGTCACAGGTAAGTGTACAGACTGACGTGAATTCGAACGT
ACTCATTTAGCCATGTTTGCTGCGATTTGGCTCGTACAGGGGGATCGATAACGCTAGTTCTCAAGGAACCCCTCGATACAGGTAATTTTGCTGCATAATT
CACCGGAATTTATCTGTGTGGTACTGTATGTGACGGATTTGCAATGGACTTTGTTGGGCTAGGTGGACTTTCGATTGCGCAGTACAACATCTTTGTATTC
CGAGATGATTCTTTCGTGAAGTGGACAAGTATTGCGGCGTCAAGTACCAGCAAAAATACAACGATCAGTATCACGCGAGATAATGAGGGCAACCCTCTAG
CTTCTGCGACTTCATTCACTTTGAAGGCTTTGGCGCTTCAAGTTGACGTTTCGTGCGACACATTGGCGGAAGATGGCTTGGAAAGTGAGGAGGTGACTGT
AGCAACAGCAGCAGCCGCTGTGCCAGCTCCACCGCCGCCTCCAGTTCTATTGCAATTGTCGGGGTGTATGGCGCAGGTAACTGCTGCACCGCCTAGTGAC
TTCGGTGGCGCTGAAGCCACTGGAATGACCGTTGGAGTATTCTTGACAACCGGAATTTTGCATGAGAGCTTCGCGGTTGCGTTATATCCGGGTATCATCA
CCATTCAAAATCTTCTGGCACGTACACGTTACTTGGTGAAGGCCTCTCTAAACACTACCCTCGGTAGTACTGACTTCAGTGAAGCCATGGCCTTTACAAC
GGAAGATCCAAGCCAACCTGGTCAGCTTGCGCAGATGAGTGTCGTTAACATTGGTCCAAGCTCGTTACAAGTACAATGGGCGGGACCGAAGACTACGGGA
GGAGGTGTCATTTCAGGTAAGCTTCACATACTGTCAGTTGCTTCTGTATGCACAGATCTGACCATGCTTTCTTCTTTATGTAGGGTATTTGATATACCAG
CGCGCTACTGATGCTAGTGCAACTCGCACGCTCATTTACAATGGGTCTGAGGACTCCTCGACGACATCATTCCTCGTTGAAGGTCTCCTCGCCGAAACTC
TGTATTTCTTTTCTGTCGTTCCGGTGAACCAGTACGGCATTTTTGGGGTGCCTGATGATAATGTGGAAATCATCACAACGTCAGCTGCTGAGGCTCCTTC
GTCTCCAACCAGCCTTGCGCAGAGCCAAGTGGATGGTGCATTCTTCGACTTGTCGTTTTCAGAGCCTTCCGAAACTGGCGGTTTTCCGATCCAGACTCTG
CAGTACATTGCACGTCTCGAATCGTTGGCATCGTGTCTCAATGACACATCAGACTGCTCTACATGCTCTCACGTGATAAATTCCGACGGTACTCTGCAAG
CTCTGGATATGAGCTCGAATCCGTGCTCGACGGGGGCTTGTGATGCTACACAAACTTGCTGCCTGAGCAGCGGAACGAAATGTGGTGTAGTAACGACGGA
GGTAAAACAGTGTGCCTCTCCTACACAGGCGGGGATTTGTCGCGTAGATGGCTTAACTATCTCTACAACGTACGTTGTCGCGCTGGCTGCAGTGAATGAC
ATGGGAAGCAGCCCATATTCAAGTAGTGTCACGATCACTACCAATGATTTTATTCTGCCAGGACCTCCACAGGTCAACCTACTATCCGCTTCAGGAGGAT
GCTTGAAACTGG