Description :
From Genome Similarity Track
Location :
Scaffold_112:54159- 55339
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_112-abinit-gene-0.35Conserved gene of unknown function

Sequence
1180 bases(100 bases per row)
CGTGTGAAGGAAGGCATGCTCAACTCGACCATCAAAGGCGGACTCACACTAAGTCTACACAGCTGGTCAACTCTGGATGGCCAGCACCTCGTGGCTTTCA
ATCTTGTCAATTCAAATGGTGACTCGTCGTGTGTATGTGTGGAAGACATGGCAACCTATGTTCCGCGCTCGGTTATTCACGCCAGCCGTGCACCAGTCGC
TCCAATCGTTGGGGGCAGCCCTAGCGTTCCTTATACGTCCTACCAGCTCGCAGACAAGATCGAAGATGTATTACACAAcTTtCATGAACAGAACATCTCT
GTCATGGGCATCGTCGCCGACTCAACGCTAGGTCTTAATGCTGCCCGTCGCGTGTGCTTAGCgaTTAGCAAACATCGCTCACTGCTCGTGGTGCCTTGCT
TTTCGCGAGTGCTCAGTGTCCTCGCAGGCGCTGTGCTCACACACCCACATTTTGTGAATGTTGTTGGTGAGATGATCGAGATTGCGGCGTACCTTCTGAA
TGGCAAGTGCGTCGACACTATTCGCACACTCAGTGGTGACCGACGGGCGTACTTTGTGCTTCCAAATCGAGAGAACTGGTTCTCTTTCGTGGAGTGCCAC
GATCGTCTCCTCCGCTACCATGACGCAATTGTCGAGTATTGTTCAAACAGCGAGCTCCATCCTCCCCACGTACTCAAGACGCTTGTGCTCCGGAATGATC
AAGGTATCTGGAAGCAGTTCGACGAATTGCGGGCATTCCTCGCACCTTTGCACGAGACCTACAGTGTCTTTTTCCAGCAGATTCGCACTGTTCACACGGG
ATCTACCAATGAGAAGACGGCCAGCGATGCTCACGAGTCTTCCAACCACGACGCTGATGCCGTTGATATTATTGAGGACGACATGGCCGCCGCGCATGGG
CTCACACTTGCGCACGTCATGTACCAGTTTGCTCGCATGACACAACAGTACCAGACACTGTTGATCACGACTTCCGAAGGCCAAGACGTCGCTCAGCTTG
TTTTGATTCACGTCGATACGATGTGGCGGCGATACGAGCTACCTGCGATGCTGATGGCGTTCGCGTTCAACTTTCACTTGGACACGACTCTGCTCGACAT
GGCCAAGCCCTGCTCATCATGGCCGTCGATCGCACAGTACTTCCAGCTCTATTACGAGCGGTGGTTTGGAGATGCCACAA