Description :
From Genome Similarity Track
Location :
contig_4:54156- 55570
Transcript NameFunction/comments
g1279.t1hypothetical protein

Sequence
1414 bases(100 bases per row)
ACGCCTGAGTGTACCGATACCCAAACGACGACGACGCTGGTGGAACTAGATGGCCACTTGAGCTGTTCTCTACAGCGCGGGACATTAAATACGTGGGTGA
ACACAAGCTGTCCTCGCACGACGAAATAGAATATAGAAAGCACTTACTTTCGCTGAATGGGGGGAGCTCGGGGCGCCGCAACGCCCCAGGGTAGGAAGCC
GGGGGCGGTGTGTAGTCGTGACGAGAGGGGGAGGATGATGCCTCAAAGTTGGTCGCCGCAAAGTTGTTATCGTTGTTCAGGCTCTGGTGGCGTTTGCGAT
TCGGGTGAGTACGCGCGTTGTCGCTGCCATGAAATAGACCCTCCAGGTCGTCCAGACCTGCACACGAAAGGCTTCTCTTGGGCGACGGCCTGCGAACAAA
TGGCATGCGTTAGCCTTCACCGCGCTGTAGCCAAACAAAGAGGCCCGGACAAACCATACCTGCTGAGCGCGGAATGTGGGTGCATGCCAGACAGGATGCG
AAACGAGCGGACTCGCGGAGGGTGGGGCGGATTGGGACGTACGCAGATGTCGAAAGCTACTTGCAGAACTCACCAAGACGAAGAATACCACCGGCCATAT
CCTTGGCAGCCGTGTGCACCCTCGCGTTAGCTCTGGCAAGTTGAGTTGAACAGCTCTCGTGCTCTCCTCGCTTGCGAATGCGCTTTGGAGCTTGAGAGGA
GGCTGTTGTCGCTTTTCTTCATCGTCGCACAACTCCCAAAACAAACGAAGCATAAAACACCAGCCAACGCAAGGGCCCGTACAAAAATAGTGGCGAAACA
GCGGGCCCAACAGCTCTTCAATCAGGATTTCTCCGCCACCCAGTCCAGACAATTATCATTAGCGCAGAGGGCTTCGGAAATCTGACAGACAAGGCAGCCA
TCGACATTGCTCGCTGCCTCAGTCGTAGGATTAGTGCTGCTATACATGAAGGCCACCTATCTATCCACGCCAACCAGCAAGCTTAAACTGGCATCGACAA
AAGAACCAAAGCAGCCTTCTTCTTTCCGTACCCTGCAACCATATACCCTGCAAGACAAACCACAGCATCTTCAAGTACTCGCACCTTCATTCTTTTCAGA
CTTTGCAGTGGCTGGGCGATTCCTTGCACACCGCTCTTCCTGTGCGATACCTGTCTCCCTCCGTCCTGCAGCGGTTGTGCTCTATGCAGTTGGAGTAATA
TCGCTCCGACAACGCAGGCGCCGACACGATGGTCCATATCCAGGACTCCCGCCTCTCAGCCTGCTATCCACACCCTGAAACTCTGCTTACTCGCTGGGAA
TGCCAACAGAGCGCAGCTTCTCCTCGAGCGTTCGGAACTCCTTATCATTCACGGCATTGAGCTCCTCGTCAACCCACTCCTCGATGCCGCGCACCTCGGG
GATGTAGTGCTTCA