Description :
From Genome Similarity Track
Location :
contig_4:54156- 55570
Transcript NameFunction/comments
g1183.t1RAW42174.1 hypothetical protein PC110_g1606 [Phytophthora cactorum
g1184.t1KUF81963.1 NifU protein 5 [Phytophthora nicotianae

Sequence
1414 bases(100 bases per row)
CTGAGTGTACCGATACCCAAACGACGACGACGCTGGTGGAACTAGATGGCCACTTGAGCTGTTCTCTACAGCGCGGGACATTAAATACGTGGGTGAACAC
AAGCTGTCCTCGCACGACGAAATAGAATATAGAAAGCACTTACTTTCGCTGAATGGGGGGAGCTCGGGGCGCCGCAACGCCCCAGGGTAGGAAGCCGGGG
GCGGTGTGTAGTCGTGACGAGAGGGGGAGGATGATGCCTCAAAGTTGGTCGCCGCAAAGTTGTTATCGTTGTTCAGGCTCTGGTGGCGTTTGCGATTCGG
GTGAGTACGCGCGTTGTCGCTGCCATGAAATAGACCCTCCAGGTCGTCCAGACCTGCACACGAAAGGCTTCTCTTGGGCGACGGCCTGCGAACAAATGGC
ATGCGTTAGCCTTCACCGCGCTGTAGCCAAACAAAGAGGCCCGGACAAACCATACCTGCTGAGCGCGGAGTGTGGGTGCATGCCAGACAGGATGCGAAAC
GAGCGGACTCGCGGAGGGTGGGGCGGATTGGGACGTACGCAGATGTCGAAAGCTACTTGCAGAACTCACCAAGACGAAGAATACCACCGGCCATATCCTT
GGCAGCCGTGTGCACCCTCGCGTTAGCTCTGGCAAGTTGAGTTGAACAGCTCTCGTGCTCTCCTCGCTTGCGAATGCGCTTTGGAGCTTGAGAGGAGGCT
GTTGTCGCTTTTCTTCATCGTCGCACAACTCCCAAAACAAACGAAGCATAAAACACCAGCCAACGCAAGGGCCCGTACAAAAATAGTGGCGAAACAGCGG
GCCCAACAGCTCTTCAATCAGGATTTCTCCGCCACCCAGTCCAGACAATTATCATTAGCGCAGAGGGCTTCGGAAATCTGACAGACAAGGCAGCCATCGA
CATTGCTCGCTGCCTCAGTCGTAGGATTAGTGCTGCTATACATGAAGGCCACCTATCTATCCACGCCAACCAGCAAGCTTAAACTGGCATCGACAAAAGA
ACCAAAGCAGCCTTCTTCTTTCCGTACCCTGCAACCATATACCCTGCAAGACAAACCACAGCATCTTCAAGTACTCGCACCTTCATTCTTTTCAGACTTT
GCAGTGGCTGGGCGATTCCTTGCACACCGCTCTTCCTGTGCGATACCTGTCTCCCTCCGTCCTGCAGCGGTTGTGCTCTATGCAGTTGGAGTAATATCGC
TCCGACAACGCAGGCGCCGACACGATGGTCCATATCCAGGACTCCCGCCTCTCAGCCTGCTATCCACACCCTGAAACTCTGCTTACTCGCTGGGAATGCC
AACAGAGCGCAGCTTCTCCTCGAGCGTTCGGAACTCCTTATCATTCACGGCATTGAGCTCCTCGTCAACCCACTCCTCGATGCCGCGCACCTCGGGGATG
TAGTGCTTCAGCAT