Description :
From Genome Similarity Track
Location :
Scaffold_19:54150- 58460
Transcript NameFunction/comments
Phyag_g560hypothetical protein PHYSODRAFT_262124
Phyag_g561conserved hypothetical protein

Sequence
4310 bases(100 bases per row)
GGAAGATCAATGCGCATAAATGATATTATCTCTTTGCATTCGGCTTGTACTGCCGTGCACAACTACTCTTGGTTACCGATTGCCGCGATGGCGCAATAAA
TTAGGCGAGAAGCAGGTCGATGGACTCCTGCACGTCTTGCCGGTAGGCATCGTTGGCCAGAATCTCCTCGTAGGCCACGCCAGACGTGTACGGCAGCGGC
TCTaggctctgcagcagctcgtccatgtcgacgtccatatcgagagctgcaaaatcagtgctggtgctgcttgaaaCGCTGCCGGCATCGCTTGCTACAG
GGCTGCATCCGCCGGTCAGTAGCTGGCCCAATTCGCCGCTGAATGGGGACATCGCATCCATGGGAAAAGCCGATGGAGAACGCGGCGAGCCCTGCACGGT
AAAGTTCTTCACGCGCTGGATGCAGCCAGTTGCGTGGGCGTCAACGCGGTGCTCGGGGCGAAcgaatttcttcttctgtttgCGCAGaccgcgtcgtcgt
cggttgATCTTCTGCTGGTACTTCTGCGCGTGGGTCTGCACCTGCTTGATGGAGCGCGTGCcgatgaaggcggcgatggagcGCCACGGGCCCGTTGGGA
ACATCTTCATGGCGTGCAGGAACTGCTCGTGCTCCTGCTCGGACCAGAGGCCGCGAGTGatcggcgtcgctggagctggaggcggagTTACCACCAGGCT
TCCTCCGTGCGTACTGGTGGGCATCATGATCATGGCGCTTGAGGCTACAatggttgttgttgtggtgctgctgctgctgcggcgggGTGCGCGGCTCGAG
CAAAAATCGGAAATGGGCCCTTCCTCGTGATTGATGTGATTaggcggaggctgctggTCACTTTGTCACTTTTTTTGCTTTGACCTTTGAGGGCGAAAAC
GGGGATGGGCAACGCTAGACGCGGCTAGGGGAAATTTATGGCTCAGAGCGGTTCTCGCGGAAAAAATTGACCAATGGCAGCTGGGGATCCCGCCGGCTCG
TCTGCTCAGTATGCCGCGGTATCTCAGATGGAAAACGAGCGCCAAAATTATCAGCATCAAATGACATCAAGTCGGCGTAATTTACGCAAGCGATagactg
ctgcaggcggccGGCTGCTGGTCAACACGACTGTGTGTGTTATCCAAGCGCGACTTGGTCCCCAAAACAGCTTTCGCGCCAACCAGCGGCGCGCAGTAGT
CGCGGCGCCAGGCGATTTGTAAAACCGCGCTGGTCAGTTGCGGCTTGACGTAGGCTATCCAGCCACGTTGTCAGAAAGATGCGAGCAGCTTTGTGCGCGG
CAACATTTTTGCAGTTTTATCTCGCGCTGCCGGTCGCAGTGCTACGATAGGCCAACGTGAAGTGTATGAGTTCTCCGCTCTAAAAGAGTTATTTGGAAAA
CCGAAGTGCATGCAAGATGCAGCATCGCACCACTGCAAGTCGTTGCTAAATCACCACGTAAAGGCCTCGAGCTGAGCCGGTTGGTATACTTTCGCGTCGC
GGTTCCGCGTGCGCGTCTGTTTGCTCTGAGATCACTCTACGGTCACACTAGTGGAAATCACTGGGGCTCGTACCGTATGggcatcttcgtcactgCGGCA
CATGTGTCGGAAAGCTTGGCTCAGTCGAGCTTTCCGCCATCGGGCGGATTGCTTCCGGTTGGAACGTCCACACTAATCGAACAGACAGCGGCATTTCGCG
CAACCGATGGTCTTATCGCATACGGTCTGAGCCATGCTCCGCCCTATCCAGATCGTTGCGACCGAGTTGCGGCGCTGGCAGTGATAGTCTTGGAAATGCA
AGCGCTTCGTGGCAGCCTAGCCTGGCTTATCCCCGAAAACCATATTGCCAAAGTCACCGAAAATTTCGGCACATCTTTGCTTGCGGCgaataaaaaaata
aattTCCTCGGCAGACTGTGGTTTGTCATCTTATGCGACATAAATGCCGTTTCACAGTCCTACGTGTTGGCGGTGCCGCTCTCCAGAAAAAGATCGGTCT
CCGCGGGCGCTGAAGAGCACTGAAGTCGcacgcgttgaagttgccctgCGATTTCTTTTTTAACAGAGCGCGCGAATACCAACGGCGGCGCCGCCGTCGC
AGTACTCGGCCTGCGAACGCGCTGCTCGCTTCGGCCGCGTTCGCCTACCCGTCGCTTGTGCGGGAGGCTCGCATGGCTCGTAGTCCCGCAGAGTGGCATG
ACCTGCATCAACTGGCTGCAGTGCGCGGTTTGCTGACTCCGCTCGTCAAACTGCGAGTGTATGCGACACCACCTGCATGCGAGCTGCACTGCTTCCGCCG
TGAGGAGGCCGCTTGGGAAGCTGTAGATGCGACGCCCcgccggcgctgctgaaaATGCGGGCACTGCCGAGCGAGTAGCTATACTTTTTTCGAGTGGATT
CCTCTCCTCCTGCACGAGTGGCTCGGCATGGTGTAACTGTGCATaggccgcagcagcgctgccgctgttggCATGCAcacgacgccagcagcagcaaaaa
cagcTCAACTCGGCcgagcgcttcaactgcggCTAAGCGCACCACTTTCGCCGCGTTTACTCCGCTGCAACCGGTTCAGCGCGTGAGTCTGTTTAAGCTG
TTTAGCTCCAGTGTCAGCCGACTTGTCTACGGCAACGAACTTTCGTCCGCGTTCGCTGGCGCTGACCTGTATGTGTGTGCCGGAAATAATATGGATCCCG
CCGTTCGCGGTgtcttcacgtcgctgcgCATCCCGCTAAATCTTGTTTTGTGGGCCCCACCAATTTTGGCTCAAGCAGCGGCACTCATGCGAGCCGCTAA
GCCGCTGCGCCGTGCAATGCTGGCCGCGCTCCGTTGGATTCATGCCGCAGGCAAGACGCGGTAGATGTGGCGTTGCCGAGCATAGCAATGCCCTGCGCTC
CCTCGCGCCTCCAGCCGAGCGATTTTCCCGCCCCGCGCACGGCTTTTATCGCAATCCACTGCTGTCGGCATGCCGAGCGGAGCTCCATTCTGCAAGGATG
AGGCCGTGCTGCGCGTGACGTGCTTCGGACGACTGAAGCATGCAGAAAATTCAAgaacgcagcgccaccattgACCACGTTTGAGCGCTAATAGTACTCG
GAGGTGTCGGTTGCTTCCCCACACCAAGGCTGCCCACATCTGCGGGTGTCTGAGGCCACGGTTGCAGCGCTCGCGGGTCTGCAAGTTAACCGCGATCACG
GTTGAGCTAAGTCGTGGCCGACTTCCTGTGTCTCAACGCGGCGCTCGCGACGGGATCTGCTATTGTCGGATGCAGGTTATCTGCGATGCCATGCCATGTT
GGCTGACGGGAAGGCTGAGTCAACTTGACCTGCTGTGTGTTGACAGCAGTCATCCGCGCCACCGCAGCGTCAAGAACCAAATACAAATGGCATTAAATCA
TTAAACTACGTCGCTGAAACTAACCGGTCTTCATCACCGTTCGCCTCtcatgccgccgccgactTTCGTCGGAGCTTGAGCGGcggctccttctcctcct
cctcctcctctttaGCCTGAACCACGTCCTCTTCCGTCTttgccgccacctcctccacttcccTCGTCGTCACGGCCACACTCTTCCTCTTCAAGCTCTT
ACgcgacgctgcggctgctgcgcgctTGTCAATCTCAAACTCAAAACCCACAGGCGTCGTGAGCTTCGGACGTCGGACGGCCGGGACGCCGACGCCTCCG
CTAGCAGAAAGAGCTCGAGAGAACTGGTCGCTCTTGCCCCGCGCGGCTCCGTGGGTCGTAGCGTTGTGGTATTTCTGCGTCTTGCGCTTCTGAGCCTGCA
CTCGCTTGCGGATGGCCgcgatctccagcagctcgcgggACGTGCGCGTCAACATATCGGCACGGGAGCGGGGCGtggccttcttcatcttgcggaACTT
AGGCGACTGCGGGATCGTCAGACGCCCATTCTCCTTAGCCACGCGAGCCAGATGGCGTCGTTTACGCGCCAGCTCTCGTGCTTCTgccagctccttgtcc
ttgccGGTTAGAACCTTCTTGCGGGAGGCGGCCAGCGACGCTTTGGTGGGCTTCAGGAGACGATCAGTGGACGAAATCGCGCGCACATTGGGGACGCGTG
TGGGTGCGCCGCGGTACAAGGCGTCCGCGTCTTCATCATACATGGGGCGCGTCGTGGGCGCCATTATCACAGGGAGCACGACGTCGCGCAACTTGATGGT
CCTCCGTGGTTGTTCTATCGACGCTTTTCTCGCGCGGGAACGACCTGtatacaaacatcaagttATGGGATTTTTGCCAGTTCAAATAATATCGACCAAT
CAAAATTTTT