Description :
From Genome Similarity Track
Location :
Scaffold_52:54148- 55646
Transcript NameFunction/comments
g18229.t1hypothetical protein
g18230.t1hypothetical protein

Sequence
1498 bases(100 bases per row)
CGTCTCGATGGCTGGCGTTTGAGTTGTCGGTGTCTCGGTCGTCGGCGTCTCGATGTCCATCGCTCTGAGATTTCGATCAATGTTCTTGCTTTGTTCTTCG
GAATGTGAATTTACTAGTGTTGTATCTCCAGATCCAGCAAACACGCAGCCCCATGTGAAATCCGTAAGAATGGCACATTCGGCGTTCACTTTGGCCACAC
AGTGCGCACCATCATAAGACGCAAAGCGAGGGTGGCATTCGGCGATGGCGATGTAACCTGCTATTGGGCACGCCCAACCGAGGGGCGTCGCCCCGAAACC
AGCACATGGTGGGCCTCGGGTATCTGGGAGCAAGTACACTGCGTCGCCTTGAACGGCCACCCCGGTGTCTGCGAGCCCCGATGAAGAAATGCAAGCGAGG
GCGACGAGTACCACAATTGACCCGGATATCATCGGGGGTCTCTTGTACAGCGTGTGGAGGTCAAGCGGTTGTGTTGGAGTTGTGCAGCAAATACGAAAGT
GAACTCAGCCTTATCAAGTCATTGGTCCGACTGGGTTGCACTTACTCGGTCTTTCACGAAACAACCTCATCGAGGAGTCCGCCCGTGCTCACATTACCAC
CCTGTAGTGTATCTGATAAGTATCCAAGATGCAAGCGAAACGTGCCAGCAAGAGCGCCGACAACGTAGGCGTGCTTCCCTTTGCGTTGCGAAAATGACGA
TTAGATCCGGAAACCAGCTACCGGTAGCTAGAGTTTAAGAGTTGTTGCTAACTCTAGAGACGGCTTGCACTTGTACATATACCTATCAGTGGCACTACTT
TAGCAATATTTTCTGCTAACTTAAATAGAAAATTTCTTATTAAATAGAAACAAACTATCGAACGTACCTAACTACATGTAATAACAAACTTTTCAGTTCG
TACGTGGCAGTCCCTTCGCCATGCAGGCGGTGCTGAGTCGCGTGCACCGCATCGTGGTGCCCCCCGAGGAACCCGAGGTGTCGCAGCCTCTCGTCCGCAG
CGTCGCCGACGCGTCTAGCTCCCCATCGACACCCGTGGTGGGTCTCAGCGCGCTGTCAAACCCGCAAAACACCTCGAACCCGACCGCTTCTACTGAAATC
CGAGCGGAAATCGCGCTGGCGGTCGAGCGTTTGCAATTTGCAACGCTCCTGGGGGAGCGCAAGAAGGCGGTGGATGCCCTTCAAGCATTAGCTCAGAAAT
TCCACGCGAATCGGAGTCCTGGCGACCGCAGGAGCAGCTCGACCGACCCCACAGTTGAAGAGCAGGAACTTGGACAGGCCGCTGTGCCTGCCGTGTTGGC
CGCCCTGGTGTCCGACCCTCGGGACACAGAGCTCATGGAGGCGATGCTCGAGTTCCTGCAGGCCATTGTGAGCCGCGCGCCCTCGGCGGCCCTTCTGCTG
CTGGAGCAGCCGCCGGCCCCTGCTACTTGGGGCACGCAGACGTGCCTCACGCTGCTGCAGGACCCGTCGCCGTGGATCCGAGGCCCTGCTATTGCCCT