Description :
From Genome Similarity Track
Location :
Scaffold_222:54147- 58878
Sequence
4731 bases(100 bases per row)
TGAAAGTTAGTGTCCCTACGTTTGATGGGAAGGAAGCGGACAGCTTGGTCTTTTGGATCAGGGAGATCGAGATCGCGCTGAGCGCACGCTAGATTCACGA
CTTGAGGTCCCAAGTGGCCTTTTCCCTTTCAAACCTGGGAGGTCGGGCAAGGGCGTGGGCTATGGCCAAAGAGACAGCCACTCCGGGATACTTTGTCTCG
TGGGAGTTCATGGCGCAGGAGATGCGTCACACATTTCTCCTGGCCAATGTGGCGTACCGTCATCGGTCTTCGTTCTTGCGGAGAGCAAGGCAAGAGGTCC
TTGCAGGACTATGTCATGGAGCTTCAGAACTTGGAGGCTGCCATGGCAGGGGCTCCGTTGTCGGAAGAGGTGAAGGTCACCGTGTTTATGGATGGTGTCC
GGGTCGGACCCGTCCGCACGGAGCTCTTTCGTCGTCAAGCGACCACGTTCAATGAAGCGGTACATATCGCTTTGTTGTAAAGTCACTGCATGCGGTCGGC
CCAGGGCCACGTCGGGGCTACGGAGGCCTCGGATGGTTCTACCCCCATGGATTTATCGTCGGCTGAGAAGACTCGCCCACGTTAAGGTGCGTGAAGGGCC
GGTGGCCGCTGTTTTGGGTGCAATGCGGTCGGGCATTACCGCAGAGATTGTCTTAAGAACCCGTGGAAGGTTGTCCACGGCAAGCCAGCTTCAGCGAAGC
ACTCTCTTAACGCCGTAAGCGTTGTAGATTCGGGAAACGTCGATTCCCAGTAGGTGCGGGACGCCCTACTGGGAAGTCAATGGCTTCCAAGACGGGAGAG
AATTTACCCCCTCCTCTTCCTGGAGAAGATGTCCCGGGGACAACACTATTGTGTTTGTCTGTGGCCGCGGTGCGGTCAAACTTAGTGGTGGTTACTGCTA
GGGTGAATGGGTACGATGACCCCATGACGGTCTTGATAGACTCAGGCGCGTCATATAACTTAGCGACGAAGGCTAGTGTGTCGAAGAATTGGGCGCTGTA
TACCAAGGCTGTGGAAGACTCCAAGAGTAACAGCAAGGTGTCAGTTCGCTTAGCGACAGGATCGATTGTATCGAATCGCAAGGTTTTGATACCTTTGGTA
ATCAAGTTTGATGAGTTTGATTCAGAAGAACCGTTCATCGTCTTGGACATGGACGATCGATACGATCTTATCTTTGGTTTATGAAGCATAAGCCATGGAT
CGACTGGCTTAGTCGCACCGTGGGTGCTAGTCACAAACCCCTTGTGGAAAGAGCTTTCGCGGGTCATGTCCCCTCCTTGTCTCGCGATGGATTTGTGCAC
GAACATCACATCCCACGTTTGGAGAGCCTCTTTGCCGGTTCGGCAGAGGCAATGGGTGAGCAAGGTTGTCGCGGATCGACTGATACCTTGGAATGCGTTG
AGGCTGGAGCAGCCTCCGCACGAGAAGTCACAACCGTGGGTGGCGATGGAAGGGGTAGTGCTGTGGTCACTATCGCTCAGGAAGTCGCAACCGTGGGTGG
CGGTGCAAATGGAAGTATTGTGGTTACTTCGGCTCAAGGAGCAGGTGTCTTTGGACGACATATACATGAAGTAGTTGTGTTTCCTCCTTCATCGGAAGAC
GCAACCGTGGGTGGTTGTGCGAGTGGTAGTGCTGCGGTCACTATCGCCCAGGAAGACGCAACCGTGGGTGATTGTGCAAGTAGGGGTGCTGTGGTCACTC
CTTCACAGGATGTCGTGGTCGTAGATCGAAGCAGCTTGAATGTAATTGCGGTGGAACCGCTTACCAAGCTCGAAGAGTTGTACGGGATTGACGAATTGTC
CCATCGGGAGTTCCTAGCGACCCTCAAGGAAGGTGCGTTAGAAGATGTGGTGCTCATACGTCAGGAAGCGACGTCAGTGGAGCTGAACAGTTCTTCGGTC
ATGGACCCAGAAGTGTTGGATGATGAGAACAAGTCTTATCGTCAGCAAAGGTATGGCTCGGCCATCTTGAAGAATCCATCGGATCCGTTTTATCCGCTGC
TAAAGGAGTTTGCGGATGTGGTCTCGGAAGATCCTCCGTCAGTGTTGCCCCTGGATAGCGGTTTACGGCATGAGATTGACCTGGAACCGGGTACTAAGTA
CTGTACTACGCGTCAAAGGCCGCTGCCTAAGGAGCAAGTGGACGCAATAGATGCGTTCTTTGCGGCAAATCATGCTGCGGGCATGGTTCGAGAATCGAAA
TCGCCATATACGTCCCCAACGTTCTATGTGCGGAAACCCAATCGGAAATGGCGCATGGTGCATGCTTTTAACAAGCTGAATGTGGCTACAGTTCTGGCTT
CGACGCCAATTCCCCGCAAAGATGTGTTGCAAAACAGTATGGCGGGGTGCAGCATCTTTAGCGCGCTCGACATGGTCGACGGCTATTACCAGCTGCTGAT
GAGGGAATCGGATATTCCCCTTAAGGCAGTGAGTACTCTCAGTGAGATGTTGTGGGAATGGTTGGTCATACCCCAAAGGCTTTCCAGCGCGCCAGCCACG
TTCAATCGGCTGGTTACCCAACTGTTTCGGCCGATGCGACACTTCGCGCAGACGTATTTTGATGACATCTTGGTCCACAGCAAGGCTGAAGGGGACAAGA
CGGATGTTGAGGTGCATATTGAGCACCTTCGGTCAGTGTTGATGTGCATGCGAGAGAATCGTCTCTTTGCGAACATCAACAAGTGCCTCTTTGGGGCGGA
AGAGATTCCCCTTTTGGGATGTTTCCTTGGGAAGGATGGAATTCGGGCGGATCCAAAGAAGGTACGGGCGATTGCGCAGTGGCCGACGCCCAAGTCCCAG
AAGGATCTGCGCAAGTGGCTGGGACTTGCAAATCATTTGCACAAATACAGCGAGAATTATGCTGAGATGGCCAGGCCATTGAAAAACTTGCTGAAGAATG
ACGTGATATGGTCATGGTCGGGAGAGGCCCAACAGACTTTTGAAGCCATCAAGATGAGCCTACAATCAGCACCAATTTTGGCGTTACCGGACGAGGGTCG
TCCGTTTAGTGTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGTTGCTTCAGCTGGATGCCTAGGGCAACGAACGTGTGATTTTGTTCCAGTCG
CGGCAGCTCAAGGCCACCGAGAAGAATTACCCAGTGCATGATAAGGAACTTTTTGAGATGAAGTATGCACTGGTCAAGTTTCGGGTTCATCTGCTAGGCA
GTAAACCGTTCGTTGTCTACACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTTTCGCAGCGCATGGGGCGTTGGTTGTCATTCTTTGC
GGAATACAACTTCACGGTGGCTTATAAGCCACGGAAGTAAAATGTGCTAGCTGACGCGTTGTCAAGGCGTCCTGATTATGAGCTGGCACGTGTGGTACAC
CTTGAATCGACACTGTTTGAGCTCATACGCGGGGCGTATTCTCAAGATCCGGACTTTTGAGGTGTTATTGAGGCGCTGGGCACCTCATCGAACGTCGTCA
AGCTGACGAAACGCCAGCAGGCACATCTCCATCGGTATAGCCTGTCCGACGGACTTCTGCTCTACAGTGTGAATCCTGGGGATGAAAAGCGGGTGGTCGT
TCCAAACGACGAAGATTTACGCCACCGGATCCTCTACGAGGCACACGATACGCCTGGCAGTGGTAACTTGGGGCGCGAGAAAACGTATACGTCTGTGGCA
CGTGAATTTGGTGGCCCCATATGTACAAATGGGTGTGGTCTTACGTAAAGACTTGTGAGACTTGTCAGCGGGTGAAGCCCCTACCGTCCTCAGCAGCGCC
GTCGCAGAGTTTGCCAGTCCCGGAGGACTGTTGGCGCTCAGTGAGCATGGACTTCATCTTTGATATACCGGCAGATAGGCATGGCCATACTGGGATTATG
GTTTTCGTGTGCCGCCTTAGCAAGATGGTGCGATTAGTGGCGGTTTGCCGAAGTGTTACGGCGCCGCAGGCGGCCCATCCCTTCATTGATCATGTGTTTC
GACATTATGGACTCCCGGAGTCTTTTGTGAGTGATCGGGATCCTCGTTTCGTTTCAGCCTTCTGGCAGCATCTCTTTCGGCTGATCGGGACTCGACTGGA
TATGTCGACAGCGAATCATCCGGAGACGGATGGTCAGACCGAACGGGTCAACCGTGTTTTGGAAGATGTGCTTCGCAGTATTTGTGTGGATGAGCCACCT
CAGTGGAGCGCTCAACTAGCGCAAGTGGAATTCGCGTTGAATAATGCAGTGCACTCTTCTACGGGTTTTCCCCGTTCTATGTGAATGGGTTGCGGCATCC
GCGTACTCCCCTATCATTGCCGAGGGCTTCTGATTTGGAGGGGGAGAGGCTGTCGCTGATGACCTAAGAGGTCTAAGTGGTGTTCGACCATCGGTCGAGC
GTGATTTTCTTACGTCTATTGAGACTGGTGAAGCCATTCGGCTCCGCGTAAGGGAAGCCATGGCTGCCGCTCAGGACCTTCAAAAGGAAAACAGTGACCG
CCATGGGCGTCGGAACACACAGGTGTTTAAGATTGGCGATTCGGTGTTGCTAAATGCTCGCAATTTACCTATACACGCAGTGTCGGCTGTAGGGATTACA
AAGCTTCGTCCGCGCTTCGTGGGTCCGTTCATGGTCATTGGTCTGCATGGCAATGCTTACACTTTGAACTTTCCATCGGCTATGGCAACGCATCCAACGT
TCTACGTTGGGATACTTAAGGCCTACCTTGA