Description :
From Genome Similarity Track
Location :
Scaffold_14:541458- 548032
Transcript NameFunction/comments
Physo_533631Eukaryotic/viral aspartic protease, active site

Sequence
6574 bases(100 bases per row)
CCGCCTCCGCGTGCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCTGGCGCAGGAAGTCGTACAGCAACCAGCCGCAATTCAGATCGAG
CTCGTCGACCCACGTCGTGTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCGCCCCTCGCGCACATTCACG
ATCTTCTCGACCTCGAAGACGTCATCCTCCAGCTCGCGCGTGGCTTCCCAGCTATCCTCCGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGGCCG
GCACCGTCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGGTGTACCTGTCGT
CTCGAGGCGCACTGCGAACGCGCTGACCAGATCGGCTACGCGGAAGGGTCCGTGCCACATGGGCGCGAGTTTGTGCGCATACCCCGGCTTCACCTGATCC
AGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATACCTCGTCGCGTTTTCAGTTTATCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCA
ACGCTTGTGCCCTTGCCACCTTGTAGTGTCGCTGGATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGC
TTTCAGCGTCGACCGAGGATCCCAGCCGCGCACTAAGAAGAACGGGGTTTCATTCCTCGTCCGGTCATGCGACGTGTTTAGCGCGCAGGTAAGACGCTCG
GCGTATTCGTCCCAGTCGCGTTGGTCGACATCTGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGG
GACGATAAGCAAGCGTCGCTCGTTGTCTCTAACCCATGAGTTTGCTGAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGC
CTCGCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCATGACGATCCTCGTG
AAGAGGTCGACCCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGA
CGATGTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGACCCTTTCCCGTTTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCCC
TGGCCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTACCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGA
AGAGTCTCCGGGATCACCAGCTTCATCATCACATCGCGATCCTCGGCGGAATCGTCGTTTCTCGGCTGGTAGTCGAGCAGCCCGCCTTCGCTCTCTTCGT
ACTGAGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTC
GTCCTGGGCGACGCGGATGCGGTCCAGGCGCAGTCGTTGCACCACCAGCTCCTCCAAGACTTCTGGAGGTCGGACCCTACGTGTTGACGTGCGTGCGGCA
GCCGAGCGCGTCGACACAGCGAGGACTTGTGCTGTCCCGAGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCATTTGCGCCGCGCGTTTTCGCGTCGCGAT
TTTCCGAGTCGAGGTTTTCCGCGTCGAGATTATCCGCGTCGGGACTGGCTGGAGACGCCATGCCGGGACTCGATGCCCGTGGTCGGATGACTTCTTCCAA
GCGATTCAGCGTCTTCAGATCTTGAATCTCTTCGGGGCTGTGCGCGTTGCGGCCTCCATGACGCTGCAGAACTTGTCCAGCCAGCATGTCGGCACTCGCG
TTTCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGGCTGGAGTCTTTTGTCGCAGCAGCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCC
CGCATCTGCCTGATGACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGCTCCTCTAGAAGAGAACATCCGAGCAGCAGCCCGAGGT
ATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCACGATCTCCCAGTTCGGCAGCTGCCAAATGACGACACTGTATGCTCCGCC
TTCTCGCTTCGCCTTGGCCGATCCGTCAAAGCTCAAAACGTGCAAGACCTCGTCGCGCGCCACGTCGGGGACTGGAATGACTACAATCCTGGACGACCAT
CTCCGTGGGGCGATCGCTTCTAGCGCCGCGTCGACGAAGGTTCGCGGGGTAATGCTCGCGGCCAGCGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATC
AGCAGATTTCCAACTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGTCGCCCCTGTAGTCCTTTGGACCGGAACAACCAGGCGAGTGTCGTGTGACG
TGTCAAGACGCGGACCGGTCTCCCTGCTAGCATCGTGTAGCACTCGTTTAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTCAGC
TCGTTGGGCTTCAACGTACGATTGGTGAACTTCACAGGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTGAGATGGCCCAGTCACTGGCGTACA
CGATCACGACGGATTCTCGGTTCGCGTCGAAGTGCTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGTCGAAGGCGCGCGTCGCGTGCGTCCA
CTTCTCATGTCCGCGGACTTCTGGATGCGTGACGTAGTCGCTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCGTACACCGCAAAATCTGCAATG
AACCGGTGGTAGTAATTGAGGCTACCGGAGAACGATTGCAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTCCAGATTCTTCGGCTTCG
CCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAGTACCACTGCTCGCA
GACATCCAGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTTGATGTACGACCTCCGACCCAGAACGGAGTGA
ATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCCGAGTGCTGTCATCCGGGGACAGCATCATGAACCCGTAGAGCGCGTTGTCGATCAAGCGTT
GGTAAATCTGCGGCGCGTTGCACAGCCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGGTGAGCCGGGCCCGGTCTGT
CATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCATGGGGTAA
ATCATCAACTGTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTTATGATCACGACAATGGGCGACGCCCACG
GCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCATTGATCAAGTCGGCGACCTTCTCTCGAAACTGCGGCGGGCTTTTCCGGACGCGTTGCGC
GACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTCGCTTCAAG
ATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCA
GCGAGAGGTCTGGCAGCATTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGTCGGACCCCTCGTGGATGAGGACCGCGTCGTCTTCCTCCTGCTCATC
AGGTTTCACCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTTTTGGCTCGTCGAGTTTTGGCTCGGCGAGTTCCGACTCCGGCGATTCTTCC
ATCGCAGCGCTTCCAGCCACAGTCGGAGGCATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCC
CCCTTCCCTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGCCGCAAGATGGCTTTAGGCGT
CGGGTATGAGGGGCGATCCGTCATCGGTCTGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGCGTCGCGCCGTACGCCAGATTCTGCCACTGC
TGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGGTTATCG
CTGCGCCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTGGACAAAGGTAGTCACCCACGACTTTGCCCGTGTCACCCACAGGAA
CGGCGCATTTCGATCCGGCCTCAGCGACTTCATGCGTGGCTCCTGGTTCGAGCCTTACAGGCGTCTTGACGTTGACCGGGTGCATCCGTGCGCCGTATAG
CGGTCTTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCATCCGCAGTGTCGATGCGCACTCCAGCGGGCACCATGAAGTTCATT
CCCAGGATTGCGAGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCG
TGTAATATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTCACGAGCAACGGTGGTGTCCAGGATGGACAC
CTCGGCACCTGTGTCGAGCAATAACACAGCACGGCAGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACATGTGCGGCGCGTAATGTTTCCAG
TATCCGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCG
CGCGTTCTTGCGTGGTACGTTCCGGGTTGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAAGCACCTCTCGCGACTTCTTGGTCACATA
TGCATAGACGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGT
GTTTATTCGGGTCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCCATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAA
GCATCGCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGACATGGCGACGTGAACCACAGTGGCGGCACCGC
GGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCTGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAACAACTTGGCGCGATCTTCGTTCG
CCACGTCTTGGTCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGCATGCACGGCGCGCGCCGG
CTGAATCGGCGGGGTCGGCGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTCTTTTTCTGGTGAACCAATCCACGTTGTCGGGCACGCAGCTTCTTC
TCCAGCGCCTCGGAGTCGGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGC
GCTTCTCTTCAGTCGTGCCCTCGGCGTATGGGATGTTGGCCCTCATGCCCGCGACGTTGAGCCGGTACAAGTAATCCAGAGGGGTCTCGTCGGGGCGTTG
AGCCGCATGGTAGTAGCGACTGGCCATTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCATGATTTCTTGACCTTCCTG
GGCAACTGGAGATACCATTGGCGCGCAGGGCCGCTCATTAGATCGCTGATCTGCCAGCACACTTCTTCGCCCGTCATCCCGTCACGCCGCGCGGCGGACT
TCAGACGGTTGAGCCACAGTCTGGCTTTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGGC
TACGCCGCCGGCTGTCGCCGTCGAGACGGCGGCCGCGGTTCTTGGCACTCCGATGTCCAAGTCGAACAGGTCAT