Description :
From Genome Similarity Track
Location :
contig_29:541455- 543052
Transcript NameFunction/comments
g6871.t1hypothetical protein

Sequence
1597 bases(100 bases per row)
AGAATGATACCGGACCTACACTTTTCAGTACAGATTTCCGGTGGACATATCCATTCCCCCCCCCCAAAGTACACGAAGCAAGCAGAATTCTTCGACGCCC
ATTGAAGCACCCGTCCTTCATCCCAGAGCTGCTCGAACTCGCGTTTGATCGCATCAAGGTGCGCCTGAGCCGTGCGCGTCTCAAATGTCTCTGCGTGGCG
GGCTCCATCGAACGCGACCGCGCTGTAGTTGCCCGAGCCTCCTAGGGTAAACTCGTTGTTGACGATGGTCCACTTGTGGTGGACCATGAAGCTGGGCACG
CGCCCAGTCTTGACAGGGATCCGACGTCCTGAAACTTGTGTAGCCACGACAAGGTTTTGGTCTGGAGCGCGCTTTGTTCGTTGATGATCATGCGAACGAC
GCAGCCTTCTGCAAGTGCCTTCAGTATGGCTTCCCCAATGCGATCGTTCGTTATGGAGATATTGCAGATGTCCAGCGAACCCCGTGGTCTGGCGGCCAAG
CCAAGGTCGTGCACAATCTTGTCCTCGGCGTCGGCGTCTCGAGAAAACCAGGTGTCCTCCTTCACTGACGTGACGTTTCGTGCAGGGCGCGTGTACTGCA
TTACGGGTGCCGGTAGACGAGCCGGCTGACTAGCCAGCTCGATCGGCACCACAATGCCACACCTGGGCTGCAAGCTCTCCCCCCGCTCGTACATGCTGTA
GTAATGCGCGACCGTTTGTGGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGATGTCCTTCTTACCATTCTGGACGAAAGCAAATGTCGGTAGACCG
AGGCATAAACCGACGCATAATCATCTCCAATCCTCCACGTTGCTGTTTGTTTGGCTCGGAAAGTCAAATGTCGAGCAACTCGCGCTCCACTGGATAAGTT
CGTTTTTTATCACTACGTTCGTTTTTTATTGATAAGTCCGTTTTGTATGTAAATTCGCTGTAAGACTTGATGAGGTCGACAAATTCAGAGCGGAAGTTTG
CCAAACCTGTGGAAACAAATGTTTGGTGGCATATTTTTTCCAGAGGTTTTGGCAAAAAATTTGCCATAGCATATTTCTTTTTACAGGTTTGGCAAAAAAG
CTCTCAATTTGTCGCAAAACCGCTTTGAATTTGAAACAGCGGTCTTTTTCTGGATTTTTACTGATATTTATGGATATTTAATAGATCTGGACCGCGCGAA
ACCGCTCTGAATTTGAGACATCGGGATATTTATGGATATTTAATGGATCTGGACCGCGAAACCGCTCTGAATTTGAGACACCAGGATATTTATGGATATT
TAATGGATATAGTTGGATATTTAATGGATATTTCTGGATATGTGGTAAGATACCGGTACTCTTCAGTATTTTTACTTTTTCTGACATAGGAATGTAATTG
GTAGCTATCCGTTCAGGGTCATGCTTGACGCCTTCACCATTGATGACTCTGTCGCACCACTTGACCTCGCGTTTGGAGAGGCTCGACTTCGCTATACCTA
ATTTGAAACCAAACCTCGCTGTAAGCTCGAAGAGTTCTTACATCATTGTCCTGATATTTTGTGTCAACATCCGCTGCATACAACAGCAAATCATCGA