Description :
From Genome Similarity Track
Location :
contig_29:541235- 543071
Transcript NameFunction/comments
g6871.t1hypothetical protein

Sequence
1836 bases(100 bases per row)
AGTGAACTACCTTCCTGGTGCGGCTTCCGCTGAGCTTTATACTTCCCCCTTTTTGGGTGTGTAGAGCCACTCAAATATCCCCCCCCCCTCCGGATTTTCA
ATTTTAGAGATTCATAACTTACGACTGACAATATATTTCCGTTCTTCTTATGACCACACACGCCAGTTCACAGTGCAACTGTCGTGATACTGCTGTGCAA
CTGGTACCGGAGCATACGCCAGAATGATACCGGACCTACACTTTTCAGTACAGATTTCCGGTGGACATATCCATTCCCCCCCCCCAAAGTACACGAAGCA
AGCAGAATTCTTCGACGCCCATTGAAGCACCCGTCCTTCATCCCAGAGCTGCTCGAACTCGCGTTTGATCGCATCAAGGTGCGCCTGAGCCGTGCGCGTC
TCAAATGTCTCTGCGTGGCGGGCTCCATCGAACGCGACCGCGCTGTAGTTGCCCGAGCCTCCTAGGGTAAACTCGTTGTTGACGATGGTCCACTTGTGGT
GGACCATGAAGCTGGGCACGCGCCCAGTCTTGACAGGGATCCGACGTCCTGAAACTTGTGTAGCCACGACAAGGTTTTGGTCTGGAGCGCGCTTTGTTCG
TTGATGATCATGCGAACGACGCAGCCTTCTGCAAGTGCCTTCAGTATGGCTTCCCCAATGCGATCGTTCGTTATGGAGATATTGCAGATGTCCAGCGAAC
CCCGTGGTCTGGCGGCCAAGCCAAGGTCGTGCACAATCTTGTCCTCGGCGTCGGCGTCTCGAGAAAACCAGGTGTCCTCCTTCACTGACGTGACGTTTCG
TGCAGGGCGCGTGTACTGCATTACGGGTGCCGGTAGACGAGCCGGCTGACTAGCCAGCTCGATCGGCACCACAATGCCACACCTGGGCTGCAAGCTCTCC
CCCCGCTCGTACATGCTGTAGTAATGCGCGACCGTTTGTGGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGATGTCCTTCTTACCATTCTGGACGA
AAGCAAATGTCGGTAGACCGAGGCATAAACCGACGCATAATCATCTCCAATCCTCCACGTTGCTGTTTGTTTGGCTCGGAAAGTCAAATGTCGAGCAACT
CGCGCTCCACTGGATAAGTTCGTTTTTTATCACTACGTTCGTTTTTTATTGATAAGTCCGTTTTGTATGTAAATTCGCTGTAAGACTTGATGAGGTCGAC
AAATTCAGAGCGGAAGTTTGCCAAACCTGTGGAAACAAATGTTTGGTGGCATATTTTTTCCAGAGGTTTTGGCAAAAAATTTGCCATAGCATATTTCTTT
TTACAGGTTTGGCAAAAAAGCTCTCAATTTGTCGCAAAACCGCTTTGAATTTGAAACAGCGGTCTTTTTCTGGATTTTTACTGATATTTATGGATATTTA
ATAGATCTGGACCGCGCGAAACCGCTCTGAATTTGAGACATCGGGATATTTATGGATATTTAATGGATCTGGACCGCGAAACCGCTCTGAATTTGAGACA
CCAGGATATTTATGGATATTTAATGGATATAGTTGGATATTTAATGGATATTTCTGGATATGTGGTAAGATACCGGTACTCTTCAGTATTTTTACTTTTT
CTGACATAGGAATGTAATTGGTAGCTATCCGTTCAGGGTCATGCTTGACGCCTTCACCATTGATGACTCTGTCGCACCACTTGACCTCGCGTTTGGAGAG
GCTCGACTTCGCTATACCTAATTTGAAACCAAACCTCGCTGTAAGCTCGAAGAGTTCTTACATCATTGTCCTGATATTTTGTGTCAACATCCGCTGCATA
CAACAGCAAATCATCGATCCAGACTAGTAAGTGCGC