Description :
From Genome Similarity Track
Location :
Scaffold_51:54112- 57718
Transcript NameFunction/comments
Phyca_LT1534123650Hypothetical protein
Phyca_LT153442367ribonuclease H

Sequence
3606 bases(100 bases per row)
gcgatgtgcgccgcggggtccccccagacccacgcgatgctcgcgaggtattgccgcttcgttgtccttcgcgatggcgccggcaatgccagccccagat
gcggtggctggcttgaatgcagtggctcgacagttgaagatccagctgtcgagcctcgcgcttgtgcaacttcaacttctcggtgtacgtcttgaagttg
ctgggctgcaccgagcccagcgacccgtacacaatcgccgcggtctgcacctgccacccctgcacccgcagctctgccacgattggctggtacttgagtg
tcttgtgatcgtggctgagctgcagcgaggagtgacgagcgccggccgcgtggtcctcgaacgtgactgccaagtcggcgatcaccatcttcttggcggc
cacgttccgcaggacgatgtcgggtcgcagagctgcgcctgtatactcaggcaccgtctggttcaggcgcagctctgtggtcgacttggctcgctcaagc
gcgccgcggatcttggacccgatctgctctaaggcgtcgtcatgacgctggcggatggcgtccatgttggacgcgcagtgattgagagcatgagccagcg
tctcggccgaggagcaggtcgggtctctgcaggtcttgctggaccgcagccgcttgcgcttgagcacggcgttcgtgtcgacctggttgaggcgggcctt
cacgccgaaccggtatgcgtcgtccgacagccccgccccggtcgacacgaacttcgcaccgaggccaccgtgcacgcgtaccgtcttgccctggtccact
agccccttccatcgggtctggtggcggatcttcatgtgcaacttcacgtgccgcagcacagtcttgtggtcgagccacttggtgtggtgcggcacgcgaa
gggcaagcgggtcttggccatctctgtcgtcttgagccgtcaggctgaggtgatggaggcggagcgtgcgctgcacgtccgtccagagggatccgatgtc
gccgttgcggcggaggcagtcagcgaagggcgaggcggcgagctcggagttgaggaagagcctcacgagctcgtcgccacgcccgcgccaatgttcttcc
tgcaggcggtagcgcttgcgtgctacctggcagacctgctccttcgcaacggccacgacggccgcgtccttggaatggagcatctgccaggcatgcgcca
cctgcagcgcctgatgcatctccacgagggactgcagccccagcccacctccagacgttggtgtgtagaagaactcggtggtggcggactgggggaggcg
cagtaggtggcgcaggccacggacgacggcgcggtcgaagccttggagctgggactggagtggtcgtaggtggcgcagcgcgtactcgaccttggggtac
acgaaggtcttgagcgccttcaccacctgccaccccgccagtccggactgcatcagcgccaccgcctctcgcttgatctgttggagcttgggttcaagct
ggaggcggtggcgcacatggtcgaagccatcgcccacacccaggtagcgatagctatcgtggagactgaggggggcgatgacttcgccttgcagctctag
gtgcacgccgtcgtcgcggaccgggttgccgcgggcgtttgtcgtcaccgctaggctggcacacttgccggggtttgcccgcaggcctgtccactcgagg
aaacgagtgacagcgtcgtggcatttacggatgccagcggcgctgtcactgaacaccttgatgtcgtcggcgtaggcggtggcacacggtcgtacaccct
cggccaacggcacccctacgccgtcgagcttctcgaggcggcgaatgagcggcacaagcgccgagatgaagaggagggggctcaggggacaaccttggta
cacgcccacctcctggcggacaggatccgtcgcgccgtccaccgcgttcgccaccacgaaagccgagtcttggtagatgttcttgcaccgggcgatgaag
cttgcgtcgacgccgaggtggcggagcacgctccacatgagctgctgcggcagtgacccgaacgcgttccgcaggtcgtaccagacgtggtacagcctgc
ggtgcgaccggcgcgtctgatccaggagcgtggttgccacgaaattgtgttcgtggcaaccattgaacgctcggaaccccttctgtgccatggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngttct
gctccagccagcgcgacagccgacgcgccagcagtccgctgtagatcttgtaaatcgcgggctgcagacagatcggtcgccagttcgttggctgcatcgg
gtcgcccttcttgtggatgaggcggacgatgcccaacttccacagggcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaagtgggcatgcagcgtggcggcgtcaatcgggcactcgtcgacgtgctcttccgccgctgtctccgcc
gaggcaccggccaatatcttggacacacacttggactcgtccttggcgaacgcctgccgtagctcttgcttggccatcgatgtccggacacgcccgacgc
gacgccgcgctcgatgtatcgcccgttggtcccgcggtgctgcttgctgcgtggcttgcatgtcgtccagcgcttcgtctagccggtgttcgcgctggtt
gcgtgtcacacgtggtggccgtcgccgttgctgctgctggtgcccaggccgtggtggtcgcgtggtgtacggctgcagcacctctcggatgcgctccggt
atggagctgatgtagccttcgccggtgtcccaactgtctgcgtcaacgatcttgctggccatgacgtcgctaagctcctggagggcgtccgctactttgt
cgcgttcctcgtcactgagttggcgcagtcgaagccgaggttgccgcgctggggctgagcctgggccgatgggcaagactgggaaggcttcgcccgcatc
tcgtgctgcaatctcggcttcgacctccatggcttcgtcgtccacgctaccatcgtctgccgctgccactggggccacacctgcactggcactggctgct
gctgcttgcggtgccggtccttgcatcgctggtgtcgtgtcggtgccacagcatcgctccatgcacgagccgtgtggctcgcactcgctgctgctcgacc
gccggtccagcgcgcggttggccagacggtctgcgtgggcgttggccttgcggtcgatgtggcggagggtgtacttctccacggagcggagcgcatgccg
gacgcg