Description :
From Genome Similarity Track
Location :
Scaffold_73:54111- 55757
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014770Similar to cap: Adenylyl cyclase-associated protein (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G014769Similar to Wipf3: WAS/WASL-interacting protein family member 3 (Rattus norvegicus)

Sequence
1646 bases(100 bases per row)
AAGGCCACACCGCAGGTCTCCGTAAAGTCACGAAGGAACAGCAAACGTGGCGCAAGGAGTACCAGGGAGTCGACGCGCCTGCCCCTGCTGCGCCAGCACC
AAAGTCAGCGGCCGCGAAGGCTCCTGTGCCCGCACCAAAGATCGCGAAGACGCCTGTGTGCGAGGTGCGCAACGGCAACTGGCAGATCGAATACCAGACG
GCCGCGGCACCGCTCACCGTGAGCGACATCAACATGAAGCAGCAGGTGTACATCTACGGGTGTGAGAACGCGACGATTATTCTCGAGGGCAAGGCCAAGA
GCATCATCTTCGACAGCTGCAAGAAGACCAAGCTGATCTTCGACGACGCCGTGTCGAGTATCGAGATCGTCAACTCGAAGAACGTGCAGGTGCAGAGCAA
GGGCCGCGTGCCGTCGGTGGCGATCGACAAGACGGATGGCTGCCTCGTGTACATCTCGTGGGAGGGCCGCGACGTGCAGTTCGTGACGTCTAAGAGCTCG
GAGATGAACGTGGCGTTCCCGTCGGGTCCGGGCAGCGACGAGTACGTCGAGCGACCGATCCCGGAGCAGTTCGTGCACCGCATCACGCCGGAGCTCACGG
TGTCCTCGGACGTCTCGGACCTGTACACGCACTAAGAAGGGAGGGAAAAATGACCCCCTGATCATGCGCGCGAGTCATGCGTTTGATGCTGTTGGGGCAG
TGCGCCCTCTCTTTCCTTTTTGCCTCTTTGTTCATGCATGTGTGGGCGCTGCCAGCAGCAGCAGCACGCAAACGACCTCGTAGCTCCTCAAGAAACGCGT
ATAAAAAGCTAACAACACGACTGTTTGGAGTCAATGAAGCTCCATGCTATGCGCACGTCTGGCCTATTTATTTGATATTGCGCAAAGCGTCGCGTATTGG
CTGATTGCATTGCGCCTATTAGAACACCCGCCCATGGCGAAGCACGCGCCACCGCATCCCGCGGCCCACGCTGCTCCAAAGGAGGGGAAGGTCGAGGAGC
CCGTGCCACCGACGCCAGCGCCCGAACCGGAGACTACGCCATGCCCGTATCTGATCCCACTGGATGCCTTCCACCAGATCTTTGATGCTTCAAGTGGCAA
TGCTAATGTTGACAGAGCGCCGCTATCGACTGCCGCACGCGTGCAGTTGCTGCAGGAGGCGCTGGGCGTGCAGCACGCGGACGCGAATCCACGCACGGCA
GCGTGGGTCGAGTTCTGCTTCGGCGTACTCTGCTTTGCGCGAGACGAGCCCGCGTGCTTCGAGAGCAACGAGAAGGTGCTCACAGTGCTGACCATCGCGA
ACTACATCTTCCAGTTTACAACAGCAAAAGGGGCGACTGCGGAAGGCGATGATAATGACGCGTCGCCATCGACGCTCTCGCTTCCGTCAGTGCAGTCGTG
CTACAACAAGTTCCGCGAACGCGTTCGTGAAGTGAGCTGCCCGCCACCGCCGCCACATTCGCCACCGACAGCTTCCAGTCAAGATGACACACACGCGTCG
TCCGATCCTGTTCTTCCATCATCTCCATCGCCGCAATTGCCACCGCCATTGGCGCAACTTTCCACGTCTGAAGTCGCGAGCTTCGTGACGTTCATGTCAG
CGACGTTCTTCCGCCACTTGCGCGCGTACCAGTTCCTCTTCACGCG