Description :
From Genome Similarity Track
Location :
Scaffold_1:5410029- 5415256
Transcript NameFunction/comments
Physo_355142pyruvate dehydrogenase E1 alpha subunit
Physo_556050Hypothetical protein

Sequence
5227 bases(100 bases per row)
TCCCCGATGCTGTGGCGAACTGCTCTTATACTGTAAGAAGCATGGGATTGGTTGATATTTTATAGTTAGTAGCTGCGATTGGACGAAAAGATGATGGATA
ATGTGCTCCGGCGGTGCGCCGCAAAGCGAGCTGCGGGGAGGGATGACCCGTCGGCGGTGGCGTCTATGCCTATCGCATACTCGCGCCAAGTCAACTCGCT
CTTCCCATCGCGTCGGCAAAGTCGCAAAGGCACTTTGGACTTCGGGGGGGATCGCCGACTGACTGCCAAGCGCCAGCGGCTCAATTGCCCTAAGACATTT
TTGCTGTATTTTAACTGGTATCTGTGTATTGAAATGCAAAATGCAGTCAGGACGAGTCCCCTGCCACAACTTTAGATTTCGTCCATTATTGCGGCATTAT
CCATCATCTCTTCCAATCAGCGCCGGCTAGACATGCATCGCAGGCTTTGTATGCACCCGGCAAAATGCCGGATGATTTGACCCGCGGCTCGAATCGGATG
GGTGACGTCAAGGAGGGGGATTTCGCACTTAGCCGGGTCGTGCACGGTTTTGCGGCCTCGGGCTGCTTGGAGCCACGCAGTCCCGAAATCACCAAGCAGC
CCGCAGCCCGCAGCCCGATCGAGATGATGATGCTCCGCCGCTCTTCCGCGCTGGCCCGCGCCGCCACGCCCGCCTCGCGCGCCTTCAACGCCGCCGCCAA
CGCCTCTGGCGAGGTCAAGTTCGAGTTCGCCTCGCCCTTCGAGCTGCACCGTGCGTTATTCATTGCATTCAGCAGCAGCCTTTCAGATATACCACCTGAA
GGATCGTGCCACGCGACTTGTGAGCTAATGACCGCTATCTATTGCTGCGTGCTGCAGGTCTCGAGGAGGGCCCGGCCGAGTTCGCCGTGACCAACCGCGA
GGAGATGCTGAGCTACTACGAGCTCATGTACACGATGCGCCGCATGGAGATCACCAACGACAACGAGTACAAGGCCCGCAACATCCGCGGTTTCTGCCAC
CTGTACGACGGCCAGGAGGCCGTGGCCACGGGCGTGGAGGCCGCTCTGGACCGCACCGACTCGTGGATCACCTCGTACCGTAACCACTGCATCATGCTGG
CCCGTGGCGCCTCGGTCAAGGACGTCCTGGCCGAGCTGTTCGGCATGTCGGCCGGCGCCACCGGCGGCAAGGGTGGCTCCATGCACTTCTACAACAAGAA
GGCCAACTTCTACGGCGGCCAGGGTATCGTCGGTGCCCAGGTGCCCGTGGGCGCCGGTCTGGCCTTCGCCAGCAAGTACAACCACAAGGGCGACGGCCTC
ATGCCCTGCGCCATCACCATGTTCGGTGACGGTGCCTCCAACCAGGGCCAGGTGTACGAGGCCGCCAACATGGCCGCCCTGTGGAAGCTGCCCGCCATCT
TCTGCATTGAGAACAACCACTACGGCATGGGCACGTCCACCGCGCGCTCGTCGTTCAACACCGACTACTACACCATGGGCAACAAGATCCCCGGTATCAA
GTGCGACGGCAACGACGTGCTCGCCGTGCGCGAGTGCACCAAGTTCCTGAAGAAGTGGTGCGGTGAGGACAACGGCCCCATCTTCGTGGAGATGAACACG
TACCGTTACCACGGCCACTCCATGTCGGACCCTGGTGTGACGTACCGTAACCGTGACGAGATCTCGCAGATGCGTGCCTCGCGCGACCCCATTGAGCTGG
TGAAGAAGCGCATGATCGAGGCCGAGCTCGCTACGGCTGACGAGATCAAGGAGCTGGAGAAGAAGGTGCGCGCCCAGGTCGTCAAGGCCACCAAGGAGGC
CAAGGCCTCGGGCAAGCCCGAGGAGGCTTCGGCTTTCGTGGACGTGTACGCCGACGACAAGGGCAAGAACGAGTACCCGCCGTTCATCCGTTTCCCCGAC
TACGCCAAGAGCCTGTACAACGGCAAGCGCCAGTAAGCACTTTGTAGTGCATCTGGAGGACGGGCACGAAGCGGCGAGAGGATTATCACCCCTCTTCAGG
ACAAAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGCGTCGCCTTGTGATTGCCCTCCCTATTTCGGCTCGCTGCGAGTATGGTGTTGAGTGCGCTGCGC
AGTGCATTAGAACCCGGCTGGCATCGCAGCTTAGCTCTAGGACAGTCTCGTATGCTTAGCGACCCCATTTACCGGCAGAATATGTAAACGCGACCGTATT
TGCCATAACATACACACGTACACACCCGCGTCTGTAGTCGTTCCGCTGCATGCAGTGGGGTTTGAATTAGCCGGGCTGTTCCCAGTGTTGGTGAGCGCTG
CATAGGGCTGCCCAGCCCCGTCAACTTGATGCCAACAAGCTGTTGGTGATTACACAGTACATGGCATCGATGGCGAACTATACTCCGCGTTGCAGTGCAA
CTTGCACCCGTCGAATCTCGGCCCGAGAGAGCGGCAAACCTATTTGTCATTTAGTGTTTCGCTTTGGCGTCCGAAGCACTACTGATAGTACGATTCAAGT
CGACGGTGTCAATGAAAAAGCTGCCCAATTCCCATGTTGAAGCTGACAACTTACTACGTTTCCATCATACAAGTTCACTTGGCCGTGGCTCCTTCTCTCG
TCTCCACTACGCGCGTGTACATGCTTCTCATCCACATACTGACTCACATTCTGCACTACTTGTGGCCGGGCATATTTTTCTACACTACTACTTCACTACT
CACTACTAGTTCACGGTCGGCCGCTTGGTGCGTCGTGTTGCTGCTGTCTCATCGCCGTCGTCATACTTCTTCCAACATTTTGGAGCGGACGGCATCTTTA
GCTGGAGTACAGCACCGTTCCAGCACCCGGGGTCGCTTCAAAGTCGCTGCCGTGGCGACGGTGACGCGGTCGACGACGCACAATTGGCCCGTTGTTGCTG
CTGCTGTTTTTGATCGGGGTGTTGCCACCGTTGCGCAGCATCGGAGCCATGAACTCGTGCTCCTGCTGCAGCGCCACGACGCGATAGTGCGAGAGCTTTC
GCGCTTGCTGCGCCAAAGTGTTCGCGTAGTTGGCGGCCACGATGATGTTCTTGGCGCGTGCCATGGCCTCATCGAACTCGAACCTTTCGTTGCCGTCGTC
CGCCTGGGGCTCTTGGTTGCTTTCGTAGTTGATCTGGATGCGCGAACGCCCAGTACGAGGATTCACTCCATTCTGCGGCGAGGTGCGTGCGTGCACCGGC
GACGGCCGCGTGATCGAGTACGTCGGCGAAGTGGACGACGACGAAGTGGACTCGTCGTCGGTGTTGTCGTTTTCGTCCGAGCCTTCGTTGTCTTCAGGCT
GACGGCCCGCGTTGCCCATGCGCATTTGGTGCAGGCGGAAGGCCTCGATCGAGATGGCCAGATCCGCTGGGCTGCCTCGGCGCTTGGCCGCGAAGAGCGC
CTTGTTGCGCATCACGAGGCCGTCGCTGAAGGAGCGACAGGGGAAGCTGGCCTTGGGGACACCGATGCTGGAGCCAGCAACGCCGGAGCCGTTGCTCTCC
TCAGCACCTGACGAGAACGTCTTGTACTCGATGAGGCGCGAGCGCACGGGATCGAGGAGATTGTCGTACGACCGACGCTTTGGAGGCTCCTCCTTGACTT
GGCCGCTGGCAACCGAAAAGCTCTGTGCACGGCCCAGCATCGGAGTGGTCTCGTTCGTGTAGGCGAAGAACTGATTCGAGCCCGTAGAGCTGAAAGACGG
CGTGGATGGGGGCTCCATGCCACTGGCAGTGTTGCGTGAGGACCGACGCGCTTCAATCACGCACGCAGTGCAGACTCGAAGCTGGCGCTCGCCGATATCG
GGCACATGAGCGCTGCGCACAGAGCTGCACGAGCTGCAGCACACTTCGCCACACTTGAGGCAGTTGTAGCGGCGGCGGCGCACGCAGAACTTCTTGGAGC
ACATGCGGCAGTGATCCTGCTCGCTCATGGGCACCACTTGCAGAGGCAGAACGATCTCCTCGCGGCCCACGCGGAAGTTCTCGGTGTACTTGAGGATGCC
GTTGATGCACTTCTCCACGTGCGACTGAATGGCCGAGTTGGCGACCCACGCGGGGAGGTCGCCGTTCTTGTCGAAGTTGCACGTGTAGGTCATGCGTAGC
TCGCCCGACCGCTTGGTCGAGTGATACATGAAGCCCATGAGCGGCACGAGGTCGCGCACGTACTTGGGGGACTCGGCGTACTTGGAGAAACCCGCGGGCG
TGTCCACCGACTCCATGATACGGAAGGCGGTCATCTGTCCCTGAGCGTCCTCGATCATGTCAACGTACTCGAGCATGAGCAGGTCGCGGTCCTTGGCGAA
CGGGCCGGAGCTCTTGAAGGCGGCCCACTTGAGCGCGACGTAGCGGTGCGGGTTGGCCGGCGTGGGCTCTACAATGTTCTGCACCACTGCGCCGTCCAGG
AAGTCGGACGACAGCATGGCCATCATCCGCTTGAAGGACGCTGTGGTCGGCGTGATGAGCGACGCCGCGACGTCCTCGATGTCACAGGCGAACTTGCACA
CGGCGTGCACGTTGCACGGCACGTTGGTTCCTGCGTTGGTGGCGTCGGCTCGGAAGAGCGAGATGCCGTGTTTCTCGTGGACGAGCGCCCACGGGATGCC
GCCAAGCAGGTCGGTGGCCTCCAGGAGGCTCTCGGTCATGCGCTTGGCGACTGTCGTGAGGCGCTCGCGGTCCTTGACGCACATCTCCGCGACGTCCTCG
GTCGGTTCGGTGTCACTGTCGTCGGTGCCGTCGGATCCTGACCCGTTCGACGAGCCGAAGCTGGAGAGCGCGCGCGGCGTGAGCGGGGTCCCGGCCAGCG
GCGACCCGGTGCTGGGGCTGTACTCTGCCATGCTGTGTGGTGTTTATTTAATGAATCGCGTTATCGTGTACGGGGGAGGCGACGCAGCGCATGCAGTTCT
TTCTACTCCTGAGGCGACGTGCGCGCGAGGGCTCGAAGGCGAAACTGAGCGATTTTCGGCAGGAGGTTGCTGCGCGTCGCACGTAACAGCTCCTGGTCAG
ACGCACGTGCTTTCGGGCCAGCGCCTCGATTTAGGGCAAACGGCCCGTTCTCTTCTATTTCTTGCTGACGTACCCCCAAAGAGGCCGGAGCAGGCGAGAG
GATCAAGCGCGTTGATATCCACGGACGGAGCGGTACGAGCGCTCATTCGAGGCCGAGGCAGCCCATGACGACGGTGGCCGGGAGCTGGTTTCGAACACGG
CGCTGCTGGACGCAGGTCAACTCGAGC