Description :
From Genome Similarity Track
Location :
Scaffold_2923:541- 2695
Sequence
2154 bases(100 bases per row)
TTAGGACTAAGGAAGTATCGGATGGGGGATGTACGAGACCTGAGTCGGGAAGACGCCAAATCCTACCATATTATCGCTACAGATTATGCAGTGGATCGGA
ATGATTTGCTCTTCTATTGTCCCCCTACGAAACGAGAGAGCGGGGATCGAGACGGATAGATGAGATTGGTGATGCCGGAAACCTTGCAACAGGACGTCCT
ACATCACTATCACACTAGCTTAGAGAGAGGACATCAGCGAATCGGTCGGACTTACCAACGGATCCGAGAATGTTTCCACGGGAGGGGACTATTCAAGAGT
GTGCAACGATATGTCGGTGAATGTGTATATTGTGAGACAGGCAAGGGCAGACCCACAATCGAAGGAGGTCTCCCGGGAATGTCCAAGCGACTAACCCGTT
CCAAATCATAGCCATGGATCACATCCCCTCGCTACCCAAGTCATTAAAAAGAAACATCGAGTTGTTGATCTTGGTGGATCTGTTTACCGGATACGTGATA
GCCTAGGCTTGCGCGTCCAGAACTGCACAGACCATCGCCAAATCGTACGAGGAGTGTGTCTTTCGCTGATTTGGGGCTAGTGAGACGATTCTTCATGATC
GGGAGCTAGGTTTCATGTCTGACTTCTTTGCGAGCCTTCAACCAGATCCTAGGGCAAAGACAGCGGGCAACTATGGCATATCGTCCGCAAGCCAATGGAT
TTGTCGAACGCATGGTACAGACGATTACAAGGGCGCTCACGATGTATGTCCTGGATTTGGATCAGCGAGATTGGGATGAGTACGCAGAGCGACTCACCTT
CGCAATGAATACCGCACAGGACAGGATCCGGGGCGATACCCCGTTCTACTGGGTACATGGATGGAATCCTCGATCCACTCTAGAAAGCGGCCATTCCGGT
GGGTAGTACCAAGAGGAGAAACCGAGACCCAAGACGATGGCGATACCAGGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGA
AGTGCGATACAGGATCGAGCGGATCGACACAACGAAGAAGCCCGTCCTCATCAAATCCAAGTTGGATCGCAAGTGTGGCTGTACTTGGATCGGGTAAAAG
AGAGAGATGCCCGTAAACTGGCCCATCTGTGGCACGGACCGAGAGAAATACGTCATGAAGTTGGAGACGGCAGGTACCGAATATCGCTTGTTCCCTGTAG
TACACGTATCCAAGCTAACACTCGTTAAAGAAAATCCAGACCGGCCTGAGATCTATCTTTCAGTGGATGGGTCCAACCGAGTGGATTTCGATGACGTTTT
ACCGGAAAATAGTTGGAACATGGACCTGGAAGCAGACGACTTCGAAGTCGAGAGGATCGCCGACATGAGATCAGGAAAACGGACCAGATACGGACGAATT
TACCGCGAATTTCCGGTATATTGGCGTGGATATGGCGAACCCAACTGGGCGGACGACGCAGATCTAAATTGTGGGGCGTTACGCCATGTTTTCTTGCGGG
GTCGAACGAATCGGAATCGAGTTGGCGTGATGTAGGCTCACAAAGAGAAATAGGAGGAGGATCCATGGGTGTGAGCCGGTCATATCGATGGGGGAGTGAA
GAAGGACCCACAGGTGGGGTGTGGGCCAGGAGGAGGAGGATAGCAGGATTAGCCAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACA
CTGACTAACGGAGGGGGGGAGGCGATGATCCGTGATCTGCTGAACTTTCATCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGCAACCT
CCGAAGCGTTCAAGTGGTAAGGCTTGAGTGTGTTGGCGAGACATGGGGATGGGGTGGAGCAGTAGTGGTAAGATCTTTACTCTGCGTCCGTAGTTGTTTC
TGGATCCCTAGGAAATATTCGAGCTTGGTACATCCAGGGCGTAGATCTGGGATCTGGTCCTAGGGTTTCCTTGCGGGTGTGTTCCCTTGCCTTTGGTTTT
CCTTTGCGTCGTACTTGCCGCCTCATGTGGCGGGATCTTGTGAGTTGAAAGCTTCTTGGGTATATTCGGCCAAGTAGTAAATCCGGTTAACACTTCGGCT
CTGCACGTGTAAAGGAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATC