Description :
From Genome Similarity Track
Location :
Scaffold_3:540518- 542299
Transcript NameFunction/comments
Phyca_LT1534503215cysteine protease family C01A, putative
Phyca_LT1534503217fumarylacetoacetate (FAA) hydrolase, putative

Sequence
1781 bases(100 bases per row)
tgcaaggccaatgcggtagttgctgggcgttcgccactgtcggcgcattggaagcagcgcactgcattgccaacggcgataaaaaagccgccacgtactc
ggagcagcagcttgtgagttgcgacaagaaagactttggttgcaacggcggtgcccctgtgtacgcgatggaatacgttcgcgacaacggtatctgtaca
gaggcaagctacccgtacacatccgttgatggcggtaatgcagcagcttgttcgaattcgtgcacgcctgttaaatcaggaattacggacattgtgcagc
tcaagtccggcgacgagagtgcgctccttggtgcattgaagaagcagccggtgatcgtctccgttgtgtcggacacgtcagcgtggaagcagtacaagag
cggcgtcatcacgtcgtgcgagaccacgacggtcgaccacgctgtgcttgcagttggctacgatgccactaccattaagatcaagaactcgtggggcacc
gactggggcgaagacggctacgtacgcattagccgcaatgcgcagggcatgggcacgtgttccgtgctcaccgacatgtcctaccccaaagtgtagtgcc
tctatctggaagaaatatacgttaattgtcagtgaagtgtaaagtaaaagttgccttttgccaacttcaacttgacaagacttcaattgtgtacaaaaca
caacgtggtgtgtgaaacatcatttcaaagtatatcacacaaccctcgcatagaattgccagtcaagcatagcctggatctgatgcctgcattgctgcgt
ttcgtgcgtctccgctccagtcttccccgcctcgccatgagcccttcttcgcgccgcttctcctcgtcgtcctcgagttccaaggccaccgccctcgtgc
gcttcgtggacgagaacggcgccattcgttgcggccaacgcacggacgacggctccactgcactgttggtcgaggacgatgaccctttgggcagtctgca
cttcacgggggagaccgcctctatcgagaaggtgctggcgcctgtggtgccctcgcagatctggtgcataggtctcaactacagtaaacacgccaaggag
accaacatgcccgaaccgacgtaccctgtactcttcgcgaagggcgtcaacgccctgcagcacccgcacgaccccgtggtaatcccccgcattgcgtccg
acccccctgaggtcgactacgagtgcgaactagctgttgtgctgaaagaagcggcttttaacgtgaccgaggaggaagcactgacttatgtcggtggata
cacttgtgccaatgacatctcggcacgtcgctggcagggaaagaagggcggaggccagtggtgccgcgcgaaaacgttcgacaccttctgtccgctggga
cctgtgcttatgacacctgaaatcatcccggacccgcagacgttggagatcgctacgtacttgaacggagagcaggtgcagaagtccaacacgagcgaca
tgatcttttcagttgccaagctcattagtcagctctcgcaagactgcacactacccaagggcactgtcattcttacgggtacacctgaggtaagttttaa
aatgcctggtttaacttactgcgagggatctaacttacttgatgttgggtgtgtcttttgtgcagggtgttggctttactcgcagcccgccgcttttcct
cgcaccaggtgacatggtggagatcgagatcgagcgtatcggtaagctcgtgaaccccgttgttggcgcttcggcgctgta