Description :
From Genome Similarity Track
Location :
Scaffold_466:5405- 9249
Transcript NameFunction/comments
Physo_109700reverse transcriptase

Sequence
3844 bases(100 bases per row)
GAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGT
CGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATA
ACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGA
TCTGCGCGATGGGTTCTATCAGATCCTAATGCGTGAGAGCGATATCCCTCTCTTGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATG
CCGCAGGGTCTGAAGAACGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGGGGCGAGCGAGATACCCGTGCTCGG
GTGCCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGCCGAACGTCAAGGAACTGCGGCAGTTC
CTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGA
CTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGTCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTG
TGACGCATCCGACTTCGCAATCGGATGTGCGCTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCT
GAGCGCAACTACCCGGTACATGACAAGGAGCTCGTTACCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCT
ATACGGGTCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACATCCGGGT
TGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATG
CGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGGAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCATGCTGGCCTACGGCTCAGCGCCTT
CTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAA
CGCGGACCGCGTTGTCGTTCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAG
ACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGTATGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTG
CGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCCTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCA
GGGGAACACGGGCGTTGTGGCCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCACGTCTG
TTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCCCTTCACTACACACCTTTGGCAAGAAGTGTTTACAC
TTCTTCGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGTAGACGGACGGCCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTA
CGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGTCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGTTATACACCGTTCTACGTG
AATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTTCTTAAGTGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGC
CGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACAAGCAGCACGCGTCTGTGCAGGGCACAGGCGCCGACAAGAGCAAGAAGAAAAAG
AAGAACGGGTCTTTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGGTAGAAACGAGCTGAACGAGTTCAGCTCGGACGTAATCA
ACTTCGATCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTCCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGG
CAACACTAATGAATTCAAGAAGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAAACATGCGGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCG
CGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGT
GGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGG
GCCAAGCGTGCGACTCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAACCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTCCTGCTTCA
GAGTGGCGAACTCACGGCTTTGAAGCTGCTCCACAGCAGCGACCTGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGT
TCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAATTATAGTATCCCGAAAACGAAGCGGCAGCC
GGTTCGTTACCGTATTCGTTGGAGAGTGTTTCCGCCCCACCAAGATACATGGGAGCCGCGGGACGTCCTGCTTGCAGGACGTTCCGGAAATGGTGAGGGC
GTACGAAGTTCACCACGCACTGCCGACGCGAAGGTAATGCGAGCGCTGTGATCACCTACAGCGCCCGAAGTCCCACGATCGTCGCGTTCCTCGCGTGCCA
AGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCATGTACCCTTTTAGGGCGCGGTCGCTCAAGCGCACCGCACCCGGAAGACACAA
CGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCACGCGTCGAGAATGTCTCGAAG
CGCTCACGGGCTTAGCCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCAC
TTTGCTGCGAGAAGGGGTTTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGTTGTAATAATCGCGCCTTTGATTGTTAACGGATCAAAGTGCT
GCTCATCCGCAACAGCATCGTCGTGGATACCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGC
AGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAG