Description :
From Genome Similarity Track
Location :
Scaffold_114:54026- 59059
Sequence
5033 bases(100 bases per row)
AATCAGCTCCTCTCTCAGACTGCTCGCAAGGCCTTGCCCTCGTGCGGTCCTCGCGTGCTAAGTGGATACCTGGGTATTGCGCTCGTGCGACTTATGTCCC
TGGTCAGTTTGCGCCGTGGTCGGCTCGCTGCTTGGGTTTGTCCACTGTGGGTGATCTAGACTTGGACCTCTTGTTCCACCACTTCTCTCGTCCCAAGCAC
TACTTGTTTTCCGTTCCGGAACCTCGCGCTCGTCCGCCTATAGAGTCCCAATGGTCTCCACGATTGGTGATCTCGGCACAAATCGCTACGTTTTACAGTC
AAAGACCATGGGACATCCTGGATCGGCCGATCGCATCTGTGTCTTTTCGCCCGACCGGCTGGTTTCAATCCTTGGTGACAGCGTACCGTGATTTTAATAA
TCATCACCGCCAGGCGCTGTGGAAGTCCACCCATGTGCTACCAATCATCGTCGTTTCAAGCCGCGCGAATGAATCTGGTATGAGCGTCTACTATGAGTAT
GAGGAAAGGCGCCGCCGACGTTCCCGATCTGGTCCTCGGTGGAAGTATGAGTTCCAGATCGTGCTGCAGGGATTGGTCGAGGGTCAGTGCGACCTCAACA
TCCTATTAGAACCCTTCTTCTTGCACTTTCCCGGACGCTTGAAGAAATGCCTGTGGCATCCGGGTTTTGGCTGCCGACAAACCAAAATCCTTTATTTGGC
CTCCGCCTTGCACCTGACGGACTCCGCCGATCACTGACGCAATCAATACCGGACGGCCATCGCTGATCACCCGGGATCGTCCATCGACTGCCTCAAGAAC
AAATTCGTAAAAAAGTGATCGGTTGTTTCTGGTGTAAAGGACCATTGTGTTTGTGGCCGCAGTCGTGACCGCATGTCGTGACTCTAAGTGCGCCTTCGTT
GTGCTTCATTCGCTTTTGTTTTTTATTCCATAATCGTTACGTTTGCTAACCATGTGGATCCTCCCCTTTGCCAGATCGCGTGGTCTATGTAGCTTTCCGC
TTGCAAACCAGACGATCACCATTCGTCGTCACGAGGTAAGCGCCTCTGGTCGCCCTAACATCTGGATTCTTCTTCGTGTACCTGCATCACTTCAACCCGA
TTCCGTTGAGTTAGATCACATTCAAATTCCTGCAACAATGCGCCACTGAGGTTTGCTTCATCCACCCATGTTTCATCATTATGACCCTTCCACTGGACCA
GGAACTGTCAGTGTGTTCTTCCATATCAAATATTGCCCCGACCTCATATCTCTAATGATGTCCACCTCGTATTCCCCTTCGGCTAAATTGCATTCCCAAC
TGCCCTCCGGCAGTTAAGATTCATCAAAATCCATTCGTTCGGTTTCTTTCACCTCCAGCCGTGCACCAGGTCGGTCAGGAAAAGTTCGTACCAATTTTAA
CTTAGAGATGTTCACGAGCGGGAACAATCGGTATGGTGTTCTTCGCACTTCCAGCCGTACTGCATTTTCCCCACACTTTTCGATCACCCGGAATATGCCA
TGCCACATGTGAGCCAGCTTCCTGGCATATCCTTCTTTCACTCGATTCAAATACAGCCACACTTGGCTACAACAGCTTATCCCATGTGACCCTTGATCAT
TGTTGTGTTGATCATTTCGGTCCTGAATAGCTTCTTTCAGCCAGTCATTCACGGTGGCCCGGGCACGTTGGTACTGTCGCTGTATGTGATAGCGCCATCT
CCTGGGGTCACGATCACGTGGTTTGGTGCATCCCAACGGAAGAGTAGCTTCCTTCGTCGTTCGAGGGTCCTTTCCGTGAATGAGATAGAACGGAGTATCA
CCCCGGACTCGATCATGCACCGTATTGATGGCGAAGGTCAATCGCTCGGTGTACTCATTCCAGTCTCGTTGGTTCACGTCTGTGACATACATCGTGAGCG
CCGTGGTCAATGTTTGGACCATCCGTTTGGCGGTGCCATTTGCCTGAAGCCGATACGTCATTGTAGCACGGTGCTTTCGGCCGGCAATACGGTTGAATGA
GCGAAAGAAATACGACATGAACCCAGCTTCGCGAGCATGACGAAAAGATTCGCTCGCTCCAAATCTCCGGGCAACGCATTCTTCATATCCCTCCGCGATC
GTTTGGGCCGTCCTCGACAAGCTAGCCTTAGCGATCACGTAGCCGGAGAACAAATCATCCCAAAAAAGCAATTCACTGTATTTTTGAATGACCGGGACAG
AGAAGGGATATAATCCATTGCGATAATCTGAAACGAGCACGTATCTTGCACGTTTCCCTGGGGTTTCTCCTCGTAGCGCCAGAAATCCCTTCCCGGTTTC
GCAGTCGACGCACTTCCCCACATACTGCTACACACTTCTGAACAAACCTCTACAATGAAAGTGTGATCGCACGCGGTGATACGTGCGCCCTACCCCTTAA
TGACCACCTTCCAGAATTGCGTGGTAGTGGTGTTGAATATCATCTTGGAGCAATTCCGGGATTTCCAGTCGAACTAGCTCACGATCATCGGGGTTTGTCG
CCGATCGTGGGAAAAAATATATCAATTTGCTTTCATCTCTCACGTAGTCTGGGGCAATCATAGCTCTTTCTTTTGCTTCTGTAGCACCCAGTTCCGTTAC
ATCTCCGACTAGATAAGTTTGAGGTTAGCGATCCAACTTTCTTTGTCTTGTGCCAGTTCTATACGGTCGAGTCGCATCTGCTGTATTACGTCGTCGTGTA
TAATGATAAATATTTCTCACACCTTCGCATGGTAGATCGCATAATTGCCGCCATCTTGATCACTTGATCAATGCCCGCTGGCATCAATATTTCTTCCAGC
CGATTGATAGCGTTCAGATCGCGGCGGCCCTGATCAGTTGGCATATTCATGCCCTTTTTCATTCGTAAAGCGGTGCTAGCCCGTCGATTTGCACTTTGAT
TCCAATCGCTCTTTACGTGTAAGAACACATATGTCGGCCACGACCTAAGTTGATCTAGGGCTTTGAGACGCAGCAATTGTATTCCTGGTGCCTTGCAATC
AATTTCACCTTGCATCTTCCTGATATCCAGGTTGAACTCCCCACAAATGACCACTCGTCCCCTTGTCTATTTCGCTAGCAGCTCGCAAATCAGCAGTAAC
CCGTGATACTCTGCCTCGTTCAATGTTAATCCAGTGTCAAAACGCGACGCGGCCGACAATATGGTCTACTCGGGTATTTCGATATCACTGCACTGTAGTC
CCACCCTTTTCTTGATAAGTGCTGATCCGTCAAAGCTGACGACCAGAAGTACTTCGCCATGTCTGATCGTAGGGGCGGCATACTGATAGTCTGTATCGGT
TGCTCCGTGATGCAATCGCGATCAACATTTCATCCATATCTTCCCGCGGTGTAATACTTGCTGCAAGGGTGCCGAGGGTTTCGTCCTTCATTTGTTCCAT
TGAATAATCTCCAGCGTCCAAGTCGACAGTAAAGCTGCCCATCTGCCAAGTCGTCCATTGAGACCTGACGACTGCATCAACCATGCCAAGGTAGAATATA
TCATGAGAACCTTAACATCCCGAGAGACCAATAGCGTATAACTTATATCCAACATCCGGAGCAGGGCCAGAACTTCCTTTTCTACAGCTCCATAATTGAC
CTCTTTTGGTTTTAACGTTCGACTTGTGAACCTAACAGGCCAATTAACTCCATCATGTTCTCGACGCAAAGCTGCGGATACCGCCCATTTTCTAGCATAA
ATTACGATCACTGGTCGGCGGTGTATATCAAAATGTTTTAGTACCGAGGTTTTGGCTACTTTAGCCTTCTATATGGTGAACGCGATATTGGCTTTTCCCA
ACGAAGAGCGACAGTATGTTCTCCATCGGAATCTTTCACTTTACTCGGAACCTGACCATTCGTTGTCACTAGTGGATGATCATGATCACCTGTTGGACGC
TGCCCGCTGTCATTATCGATCTCAGTATAATGGCCATGATCATAGCTAGGTGGGCCTTCAACTTCCGTGTTATGCGAACACCTGATCTCATGAAAATCAG
CCTTCCTCCATTCGTACAAGACCGACGCATGTATGGCGAAAACTTCAATGAACAGGCTGTAATAGTTCAGGCTTTCTAGGAAGGACTGCATTGACCGTAG
TGTCCGGGCAAAAGGAATGTCACCAACGACCCGAGATCCTTCGAGTCCGCTTTGATTCCTTTTATTAACACTTAGTGCGCGAGGTACTCAACATTGTTTC
GTCCCCAGACGCGCTTAGGTAGGCTGATCAACAAATTACACTGATCACATACTTTCAACAGTCTTTCCACCTTTCGATAGAGAGACGTCCAAGATGACGC
TGAAATTATAATGTCATTAATGTTTTTAGGACCTTCTTCCGAGAACCGAAGGATTTCGGTGCACTTTTTGGCTCGCCGTCTGCAAAGACATCGATCTATT
GAGACGCCTCGTGGTCACTTGACTTCTGCCGATCCCCGATCATAAGATATCCATATAACGCGTTATCCACCATACGCTGATATATCTGCGGCGCATTCTT
CATCCTGAACGGCATGCTCAACCATTTATACAGACCCGAGGGCGTGATAAAAGCAGAGATCAATCGTGCCCTTTCCGCCATCTCCACAACCCAGAATCCG
CTGGCCATATCCAATGAACAGTACCATAGCGCTTTGTCCAGATCCTGCAACAAGTCGTTGATTAGGGGCATGGGATATACCATCAGCCTCGTCGATTAGG
AAATCCTTCGGTAGTTATAAATAGTCGTATGTTCACCCCATTCTTTTTCACGATCACTACGATCGGCGACGCCCATGGCGAAGTTGAGGAACATATGATT
CTTGCCGATAGTAACCCTTTAATCAGGTCCGCCAACTTTTCACGGAGCTTTGGGGCAACTGGCCTTACTCGTTGGACGATCGGGGCTGCTTCTCCAACAC
CTAATATCGCATATTACACCTCGCGCAGCAGGTGGGAGGGCATTTCCTTTGCCATCAGAAGGTGTCGTTTCTTCCAGATCAGCTGACGTAATTCTTCTTG
CTCTTTGGTCAATGGGACCCCTGGGTCGCTTAC