Description :
From Genome Similarity Track
Location :
Scaffold_1:54025- 55288
Transcript NameFunction/comments
Aphas_H257_00024Equilibrative nucleoside transporter 4

Sequence
1263 bases(100 bases per row)
GTGCTGGACGAGATCAAGCAGCACAAGGTGTTCATCACGGGGTCGCTCATCGTGCTGGAAGCGTCCGTCATGTGGGCGTACTTCTCGTGCTTGTCGGCGC
AGGACTACTACAAGAAGGCCTTTCCGTCTGTGAACTTTGACTTCCTCACCACGCCGCTGCTCACGTGGCCGTTGGTGATTGGACACGTGCTACAGGCGGG
GTTCCACATCCGCCTGAGCTACAAGTACCGCGTGTCGATCGGGTACTTTCTCTTCGCACTGGCAGCCACCGTCATCATCGCCCAGGACTTTCTCACGCTC
GACAACACGGTCGCGGCGTACGCGGTGCTGGCCAGCTTTGCCGTCGTGGGCATCGCGCACTCGGTCGTGGAGCCGGCCTTTTACCTCATCGCGGCGCTCT
TCCCCGACGAAGACTCGACGCACGCCGTGCAGATCGGCAACGTCGCCGCCGGCGTGATCAACATCGCGCTAAGCACACTCATCCGCGTGTTTGTCGGGGG
GTTCGACCTGGACGAGAGCCGCACCAGCGTCACGCTGTCCTTCTACCTCTTCATGGGCCTGCTTCTCGTGGTATGCGTCGTGGCTCTTGTGGTCTTCCAC
AACTTGGAGGCTCTGCCCTGCGTCAAGTACCTGCTCGACCGAGCGGACGACGACCACTCCAAGTACGGCCACCCGTCGCTCCCCGACTTGTGGGCCAAGT
ACTGGCGCGTGTCCCAGACGATCGTTCTGCCCATGGTGGCGCAGTTTATGATCTTCTTCTGCTCCCTCGCGCTCTTTCCGGGCGTCGGCTGCGCGTCCAG
CCTGCACGTGCTAGATTCGGCGTCCGTACCCGCCGCGTGGTTCTGCTCCCCGGGCATCATCGGCGCCTACAACGTCGGCGACTTTCTTGGACGGATCGTG
TGCACCAAGGCCGTGTACACCATGCTCACTCTCCGATCGTGTTTTGTGCTGTCGCTCCTTCGGTGGCTGTTGCTGCCGCTGCTGCTCCTGGGCACAGCCT
CGAGCCCCCTCTACGCGTTCGAGGGGGTTCCCGTGGTCGGGTTGTACTGGGCACTTGGCCTGAACGTGCTGCTGGGCTTCACCGCCGGCATGTTCAGTAC
CATCACTATGGGGCTGGCCCCCCGCCTCGTCGCGCAGGAGGACCGCGAGGCGGCGGGCTCGCTCATGGTGCTCAGTCTCTTCCTTGGCCTAGCGCTCGGC
TCGACGTTTGGCTTTGTGCTCGGTAGCAACCACTGGCTCGACATTGGGTTGTAGAATCACTAC