Description :
From Genome Similarity Track
Location :
Scaffold_712:5401- 6866
Transcript NameFunction/comments
Phyag_g7627conserved hypothetical protein
Phyag_g7628hypothetical protein PHYSODRAFT_345188

Sequence
1465 bases(100 bases per row)
GAAGAGCGAGCTATGCTCGCCACTTTCTGAGGATTTGGCGATGCAGCAATTATACCTGTCGAGATTTAACTTATCGCAAGCTGCTTACGGCTGCTCTAAG
ACGATTTCTCTCGCACAGCGGACTGAGAGGAAGGCTTTCAGAAAGGAGGTGCAGCTATTCGCGCAGGCGAAGGTTACGTCTGCATCACCAGTGAACCAGA
ATCAGGAGGGAGATAGTCGAAAGCGCAAGAAGTAGGCAACGCAATATGTTCGTTAATGGAATTACAAAGCTGACATCGTAATAGTCAAAACCAGCTTTCA
TCCTTTTGCACATCTACTGTGTGTGAAGCGTCTGTTTGCTTCCTACAGCTTCACAGCAGGCTTGGGTTTCTTGTTATCACCTTCCTTGATAGCCTTCAGT
TGGTCCAACAAGTATGCCAAGTCGAACGCCTTTTCCTTCAGGTAGTGGTAGCGGTCGCTGGCACTGAAGTGACCCGATGACAAGTCCATCTTCAAGAGGA
CCTCATTTTGGTCGCTCTTCATATCACGCAGCTTAGCTACCCACTTGGTGGGCTCCCAGTAGGCCACGCGCGGATCAAACAACCCGCTCGTGACAAGAAT
ATTTGGGTACGCTTGCTGCTTCACATTCTCGTATGGTGAGTAGCTGAGCATGTACTCGAAGTACGCCTTCTCGTTCGGGTTGCCCCACTCCTCCCATTCC
CCAGTCGTTAACGGGATTGAGGCGTCACTCATGGTGTTCATTACATCCACGAATGGCACACCAGCGATCGCAGCCGTAAACAGGTCAGGACGCATGTTCA
GCACTGACCCCATAAGCAATCCACCAGCGCTGCGGCCTTCACAGGTCATCTTGTTGGGGCTCGTGTACCCAGCACTGATCAAATGCTCAGCACAATTGAT
GAAATCCGTGAAAgtgttgatcttcttcttgtacttTGCGTCCTCGTACCACGTCCGGCCCATTTCACCACCTCCTCGGATATGCGCGATTGCGTAGATT
ACACCTCTGTCTAGAAGAGGCAGAATGGACGAAACGAAGCTCGGGTCGATCGGGACCTCATACGACCCGTAACCATACAGATGCAGCGGCTGGCGGTCTT
GAGAGCGCATGTCCGAGCGGTATACAAGCGAGATAGGCACCATGGTTCCGTCGCTTGCCTTTGCTTCCAAGCGCTCAGTCTTGTAGAGCGATCGATCGTA
GTTCGGGACaggcttctccttcagcagcgtggaTTCGCGTGTGTTGACGTCGTAGTCGAACGTTGTCCAGGGAGTAGTCATCGACGAGTAAATGAAGCGG
TACTTGTCAGTGTCAAAGTCACGGTTGACAGAGCCGGAGACAGTGTAGCTAGCCTCCTTGAACGTGATCTGGCGACGAGCATGCTTGTTGTCGCCCTCCG
GAACAATGACCCAGAGCTGCGAGTAGCCGCCCTGTCGACCCTCCATGACCATAAAGTCCTTGAAG